Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.2, Problem 1TC
Summary Introduction
To determine:
The reason why so many
Introduction:
Messenger RNA is a large category of RNA molecules.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A eukaryotic mRNA has 703 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA?Question 26 options:
A)
199
B)
200
C)
201
D)
300
E)
700
What is a gene?
Why are genes for rRNA and tRNA considered to be genes even though they do not produce polypeptides?
According to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.
Chapter 13 Solutions
Biology
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardWhich of the following is an example of the degeneracy of the genetic code?Group of answer choices a) each codon specifies more than one amino acid b) the genetic code is not degenerate c) an amino acid can have more than one codon d) None of the abovearrow_forward
- Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch of DNA in the nucleus. Each nucleobase on the DNA produces a matching nucleobase on this molecule. Every 3-base codon specifies an amino acid in a protein. What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts. Note: if there is more than one possible answer, separate each answer with a comma. x 5arrow_forwardWhat is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of DNA is changed, will the base sequence of the mRNA made during transcription be changed? If the base sequence of the mRNA is changed will the sequence of amino acids obtained during translation change? If the primary structure of a protein is changed, will it's function change? If the function of the protein changes, will the organism have a different characteristic? Do introns get read during translation?arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardSeveral different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNAarrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
- What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forwardWhat is meant by the universality of the genetic code?arrow_forwardWhich of the following regulatory sequence allows transcription to continue? a) Sequence 4 b) Sequence 1 c) Sequence 2 d) Sequence 3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License