Concepts of Biology
1st Edition
ISBN: 9781938168116
Author: Samantha Fowler, Rebecca Roush, James Wise
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 15CTQ
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Transcribe and translate the following DNA sequence of the coding strand:
5'-ATGGCCCGGTTATAAGCA-3'
Transcribe the following strand of DNA into RNA:
5'-AAGTTCGA-3'
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI:
5'-GGTATCCGCGGAGCTCAAATA-3'
3'-CCATAGGCGCCTCGAGTTTAT-5'
Chapter 9 Solutions
Concepts of Biology
Ch. 9 - Figure 9.10 You isolate a cell strain in which the...Ch. 9 - Which of the following does cytosine pair with? a....Ch. 9 - Prokaryotes contain a ______ chromosome, and...Ch. 9 - DNA replicates by which of the following models?...Ch. 9 - The initial mechanism for repairing nucleotide...Ch. 9 - A promoter is ______. a. a specific sequence of...Ch. 9 - Portions of eukaryotic mRNA sequence that are...Ch. 9 - The RNA components of ribosomes are synthesized in...Ch. 9 - How long would the peptide be that is translated...Ch. 9 - Control of gene expression in eukaryotic cells...
Ch. 9 - Post-translational control refers to: a....Ch. 9 - Describe the organization of the eukaryotic...Ch. 9 - Describe the structure and complementary base...Ch. 9 - How do the linear chromosomes in eukaryotes ensure...Ch. 9 - Transcribe and translate the following DNA...Ch. 9 - Describe how controlling gene expression will...
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth
EVOLUTION CONNECTION Describe how gene flow, genetic drift, and natural sclection all can influence macroevolut...
Campbell Biology (10th Edition)
In Drosophila, a cross was made between femalesall expressing the three X-linked recessive traits scute bristle...
Concepts of Genetics (12th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (5th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forward
- 2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGarrow_forwardProvide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’a. What is the mRNA transcript of the anticoding strand of the DNA model?arrow_forward
- Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post herearrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardGiven this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY