Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 1, Problem 3CT
Haemophilus influenzae does not cause flu, but it received its name because it was once thought to be the cause. Explain how a proper application of Koch’s postulates would have prevented this error in nomenclature.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What genus was the organism that spread through the NIH hospital in bethesda, maryland?
pneumoniae
stenotrophomonas
staphylococcus
klebsiella
Why are Koch’s postulates not sufficient to establish the cause of all infectious diseases?
A. What is Pasteur’s “Germ Theory of Disease?. How did he discover this principle? B. What major obstacle did he have to overcome (A philosophical concept) to establish the validity of the theory.
Chapter 1 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 1 - What does the science of microbiology study?Ch. 1 - Are most microorganisms harmful or harmless to...Ch. 1 - Patty is a mother to 14-year-old twins and works...Ch. 1 - What scientific device did van Leeuwenhoek create?Ch. 1 - Prob. 2MICCh. 1 - Van Leeuwenhoek described bacteria, archaea,...Ch. 1 - All eukaryotic cells contain most of their genetic...Ch. 1 - What term describes the idea that living organisms...Ch. 1 - The investigations of which researcher finally...Ch. 1 - Today we understand that yeasts and bacteria can...
Ch. 1 - What industry has the work of Pasteur most...Ch. 1 - Which researcher ultimately gave us a method for...Ch. 1 - Which researcher developed the staining technique...Ch. 1 - Prob. 11MICCh. 1 - The use of antiseptic chemicals during surgical...Ch. 1 - Prob. 13MICCh. 1 - Some people consider Leeuwenhoek the Father of...Ch. 1 - Why might Nightingale be considered the Mother of...Ch. 1 - Prob. 3TMWCh. 1 - In the late 18th century, Philadelphia was one of...Ch. 1 - Emerging Disease Case Study Variant...Ch. 1 - Prob. 1MCFUCh. 1 - Dr. Andrews has a lot of questions tot Patty. When...Ch. 1 - Which of the following microorganisms are not...Ch. 1 - Prob. 2MCCh. 1 - In which habitat would you most likely find...Ch. 1 - Of the following scientists, who first promulgated...Ch. 1 - Which of the following scientists hypothesized...Ch. 1 - Prob. 6MCCh. 1 - Prob. 7MCCh. 1 - Prob. 8MCCh. 1 - Prob. 9MCCh. 1 - The laboratory of Robert Koch contributed which of...Ch. 1 - Prob. 1FIBCh. 1 - Prob. 2FIBCh. 1 - Chemotherapy _______________Ch. 1 - Prob. 4FIBCh. 1 - Infection control _______________Ch. 1 - Prob. 6FIBCh. 1 - Epidemiology _______________Ch. 1 - Biotechnology _______________Ch. 1 - Prob. 9FIBCh. 1 - Why was the theory of spontaneous generation a...Ch. 1 - Discuss the significant difference between the...Ch. 1 - List six types of microorganisms.Ch. 1 - Defend this statement: The investigations of...Ch. 1 - Why would a macroscopic tapeworm be studied in...Ch. 1 - Describe what has been called the Golden Age of...Ch. 1 - List four major questions that drive...Ch. 1 - Prob. 8SACh. 1 - Prob. 9SACh. 1 - What does the term HAI (nosocomial infection) have...Ch. 1 - Match each of the following descriptions with the...Ch. 1 - Prob. 1VICh. 1 - Prob. 2VICh. 1 - If Robert Koch had become interested in a viral...Ch. 1 - In 1911, the Polish scientist Casimir Funk...Ch. 1 - Haemophilus influenzae does not cause flu, but it...Ch. 1 - Just before winter break in early December, your...Ch. 1 - Design an experiment to prove that microbes do not...Ch. 1 - Prob. 6CTCh. 1 - Compare and contrast the investigations of Redi,...Ch. 1 - If you were a career counselor directing a student...Ch. 1 - A few bacteria produce disease because they derive...Ch. 1 - How might the debate over spontaneous generation...Ch. 1 - French microbiologists, led by Pasteur, tried to...Ch. 1 - Why arent Kochs postulates always useful in...Ch. 1 - Albert Kluyver said, From elephant to ......Ch. 1 - The ability of farmers around the world to produce...Ch. 1 - Prob. 15CTCh. 1 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the Koch's Postulates, support the findings that Mycobacterium tuberculosis is the causative agent of tuberculosis. Specifically, you have to provide brief narratives/pictures/proofs and sources that support the postulate listed below: The organism must be isolated from the newly infected animals and cultured again in the laboratory, after which it should be seen to be the same as the original organism.arrow_forwardRobert Koch developed a set of criteria (postulates) for conclusively demonstrating the aetiology (specific cause) of an infectious disease. Which of the following is not a postulate? The infectious agent must be isolated and cultured in vitro The disease is reproduced when a pure culture of the infectious agent is inoculated into a new susceptible host The infectious agent can be recovered from the experimentally-infected host The infectious agent is present in most cases of the diseasearrow_forwardThe following are the limitations of Koch's postulates EXCEPT: A. some pathogens cannot grow on artificial media and therefore cannot be identified as the causative agent of the disease B. some diseases involve multiple pathogens which produce similar symptoms making it difficult to pinpoint the causative agent C. some diseases are host-specific and re-inoculation may pose ethical concerns D. some microorganisms are present in the body fluids of the infected animal which make them difficult to be culturedarrow_forward
- What is the purpose of Koch’s postulates?arrow_forwardList the main features of Koch's postulates and then explain how it's difficult to prove them for certain diseases?arrow_forwardCapsules are virulence factors (responsible for pathogenicity). Name two bacteria that are capsulated and pathogenic.arrow_forward
- Choose the false statement: (Regarding Pasteur’s famous experiment) The swan necked flasks were important because they allowed the broth to remain sterile, while still remaining open to the atmosphere. Pasteur’s work with the swan neck flasks was only of importance to the food industry; his work occurred long before anyone, including Pasteur, had any awareness that diseases could be caused by microscopic agents. The swan necked flasks were used to prove that life could only arise from pre-existing cells.arrow_forwardWhat is the Germ Theory of Disease? List the contributions of Louis Pasteur, Robert Koch, and Joseph Lister in the germ theory.arrow_forwardPut Koch’s postulates in order.(a) The disease organism must be isolated in pure culture.(b) The disease organism must be recovered from the in-oculated animal.(c) The specific causative agent must be found in every caseof the disease.(d) Inoculation of a sample of the culture into a healthy, sus-ceptible animal must produce the same disease.arrow_forward
- Explain the steps involved in using Koch's postulate to establish the link between a suspected microorganism and disease.arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forwardIdentify the genus that best fits each of the following descriptions: a. This organism can produce a fuel used for home heating and for generating electricity. b. This gram-positive genus presents the greatest source of bacterial damage to the beekeeping industry. c. This gram-positive rod is used in dairy fermentations. d. This gammaproteobacterial genus is well suited to degrade hydrocarbons in an oil spill.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License