How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'
Q: What effect does a thymine dimer have on DNA synthesis?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the…
A: Most of the animals have ‘Deoxyribonucleic acid’ (DNA) as their genetic material. Some lower…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: what is the adenine content
A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…
A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…
Q: Questión 13 Which of the following DNA parts actually refers to a six -membered heterocyclic ring? A…
A: DNA and RNA are macromolecules that make up nucleic acid. DNA (Deoxyribonucleic acid) is a genetic…
Q: What kind of DNA damage is depicted in this picture: HN H20 HO ar g O strand breakage O base…
A: DNA damage is a change in the basic structure of DNA that is not itself replicated when the DNA is…
Q: What type of bonds does DNA ligase create between adjacent nucleotides? O a peptide O…
A: DNA replication refers to the sunthesis of DNA from the parental DNA. It takes place in the nucleus.…
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: Make up your own DNA palindrome, of at least 6 bases long.
A: PALINDROME: The word 'palindrome' symbolizes number, phrase and sequence of characters…
Q: 7. How many hydrogen bonds exist between this DNA strand and its complementary strand?…
A: The DNA strand is a double helical strand which consists of two strands that run in an anti-parallel…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Which of these molecules links the most of the individual DNA nucleotides together on the newly…
A: ENZYME:- It is defined as a complex biological catalyst i.e produced by a living organisms in its…
Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…
A: DNA polymerase moves along the template strand in a 3'–5' direction, and the daughter strand is…
Q: which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc…
A: DNA is the main store house of genetic information in our body. DNA condensed to form chromosome,…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…
A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…
Q: What forces hold the two individual strands of DNA together to form a double helix? a. ionic bonds…
A: DNA is a type of nucleic acid. It is a polymer of nucleotides. A nucleotide is made up of sugar,…
Q: A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a…
A: The degree of super coiling in a DNA molecule is termed as supercoiling density. It is denoted by…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…
A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”
A: Substitution is a type of genetic mutation in which there are three possibilities after the…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of DNA, making sure its…
A: According to the question, we have to give a complementary strand of DNA for the following DNA…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…
A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…
Q: What does it mean that one end of a DNA strand is the 5' end? O This end has been primed 5 times.…
A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?
A: DNA molecule has got two antiparallel helix or strands winded together. If we know the sequence of…
Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: Cuble stranded DNA molecule of 50 base pars (100 nucleotides total) contains 15 cytosine bases (C).…
A: DNA is a double stranded helix which is a hereditary material of organisms. It contains 4 nucleotide…
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: Write the DNA strand that is complementary to the strand shown below. Be sure to mark the ends of…
A: DNA is a polymer of nucleotides and a double-stranded molecule.
Q: In DNA one strand runs "upside-up" while the other one runs in the opposite direction, "upside-down"…
A: The deoxyribonucleic acid (DNA) is the genetic material that consists of all the information…
Q: If dhe sequence and directionality of one strand of DNA 1s 5-GCTAG-3', what is the sequence and…
A: DNA stands for deoxyribonucleic acid is composed of two polyneuclotide chains that could around each…
Q: A single strand of RNA is 20% U. What can you predict about the percentages of the remaining bases?
A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…
Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G
A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…
Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…
A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…
Q: What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication?…
A: DNA replication is a process that involves the formation of a new identical DNA strand from an…
Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
Q: Which nitrogenous base correctly pairs with adenine on the DNA strand during replication? O uracil O…
A: -the adenine pairs with thymine.
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: If I have a strand of DNA that has the base pairs as below, what would the base pairs be on the…
A: Adenine complements with thymine and cytosine complements with guanine in a DNA strand. According to…
Q: The DNA double helix holds together because the base pairs on each strand are attracted to each…
A: Cells are composed of macromolecules that have monomere units and are vital for structural and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GCGACCG-3"What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure? TAAGTACATTACCCCG ACTTCTTCTCCGCTGC GACCGTATGCACGGTC GCCCACGCCAGTAGTG
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugarGive the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-TATGGCATAC-3'
- If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
- Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandWhat is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?