Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence 5'-TATGGCATAC-3'
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this…
A: Deoxyribonucleic (DNA) acid is a double helix structure, which is composed of nucleotides joined by…
Q: Complete the structure of a DNA molecule. Label each base A, T, G, C. Sugar (s) Phosphate (P)…
A: DNA stands for Deoxyribonucleic acid is a molecule that consists of genetic material of an organism.…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: Write the sequence of the complementary strand of the following portion of a DNA molecule: 5…
A: DNA (Deoxyribonucleic acid) is the primary genetic material for most life forms. However, certain…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC…
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other…
Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Write the complementary sequence of DNA AGCTAT AGC
A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…
Q: Give
A: Introduction:- The central dogma of biological sciences explains how genetic information is…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto…
A: Nitrous acid, a potent chemical mutagen, exerts its effect by the deamination of the amino groups of…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…
A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…
Q: Regarding the diagram below, this enzyme is responsible for creating an exact replica of DNA in one…
A: DNA replication is the process of replication of the DNA material in a semi-conservative manner.…
Q: A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a…
A: The degree of super coiling in a DNA molecule is termed as supercoiling density. It is denoted by…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Create the complementary strand for the DNA strand. ATTTGGTT
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…
A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the…
A: Introduction The DNA helix acts as a template for its own duplication. Because the nucleotide A will…
Q: If one strand of a DNA double helix has the sequence GTCCAT what is the sequence of the other strand…
A: By the rule of complementarity, every A is bound to T and G is bound to C.
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: Which of the following statements are true about doublestranded DNA?a. A + C = T + Gb. A + G = C +…
A: DNA is formed of molecules known as nucleotides. Every nucleotide molecule is composed of a sugar…
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…
A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…
Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…
A: The form of DNA, known as a double helix, is made up of two connected strands that loop around one…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base…
A: Two strands of DNA both are antiparallel and complementary to each other.
Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…
Q: A DNA antisense strand contains the following ucleotide base sequence CGA TIT GGT TGA 37. From thin,…
A:
Q: Fill in the palindromic sequence of the given DNA strand containing six bases.
A: A palindromic DNA sequence is a sequence made of nucleic acids with double helix of DNA /RNA that…
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: DNA is a nucleic acid molecule made of monomer units called nucleotides. The nucleotides forming DNA…
Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence
5'-TATGGCATAC-3'
Step by step
Solved in 3 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate
- What is the term applied to the trinucleotide shown by the arrow? 5' Py U AU AGGCC G C G ACCACCUGeWrite the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.AU Py U AGGC C UGGC G GG C Jc What modified nucleoside base is indicated by the arrow? dihydrouracil pseudouracil -ACC.Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'