7:12 What is not true for Sequence tagged site (STS) markers: O cannot be mapped by fluorescence in situ hybridization (FISH) O subset of STS markers are known as expressed sequence tag (EST) markers O can readily be screened by a PCR assay O short DNA sequences that occur at a unique location in the genome
Q: t does it mean to say that sponges are monoecious?
A:
Q: Sponges A Cnidarians Ancestral colonial protist Flatworms Molluscs B Annelids Nematodes E Arthropods...
A: Tissue is a collection of cells with similar structures that work collectively as a unit.
Q: Describe the characteristics of a heritable molecule. Why is DNA a good heritable molecule?
A: Given: The characteristics of a heritable molecule DNA.The DNA is a molecule that encodes the geneti...
Q: Trace the steps in fat digestion, absorption, and transport. What does HDL do?
A: Introduction: Fat is one of the three main macronutrients like proteins and carbohydrates.Fats prod...
Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding se...
A: Most eukaryotic genomes are bigger and more complicated than prokaryotic genomes. Eukaryotic genomes...
Q: What is Imagery ?
A:
Q: Given that selection cannot favor traits that lower fitness, what might cause a population to move d...
A: The Adaptive Landscape was introduced to the public for the first time in the 1932 publication. Wrig...
Q: I am a gram-negative bacteria, only a chemoheterotroph, a pathogen and spiral shaped. What am I? Gro...
A: Chemoheterotrophs are bacteria that get their energy from organic chemical molecules and get their c...
Q: In the topic about prokaryotic gene expression regulation, we learned about the LacI-, LacIS, and La...
A: The mutation is considered as a way in which there is the occurrence of diversity in genes. The proc...
Q: This is compact bone, please use ARROWS to identify the following: osteon lamella lacuna canaliculi...
A:
Q: How do BRCA1 and BRCA2 function in regard to cell proliferation (are they proto-oncogenes, oncogenes...
A: jjBRCA proteins play an important role in a variety of biological functions. In response to DNA dama...
Q: High-lipid foods are more susceptible to microbial spoilage than high-carbohydrate foods. True or Fa...
A: The given statement is True because High-Lipid foods are primarily oils (liquid) and fats (solid) an...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A c...
Q: How have the processes of domesticating creatures such as cats, cattle, chickensl, and fish remained...
A: Domestication means adaptation of animal which took longer time to undergo evolution.
Q: What major movements of ions account for each phase of the action potential of a typical myocardial ...
A: Action potential The rapid rise in the voltage of the membrane potential across the cellular membra...
Q: Which of the following sequences correctly describes the overall process of metabolizing glucose? O ...
A: Step by step description of the four stages of Metabolizing Glucose. 1. Glycolysis:- In glycolysis,...
Q: #5 Explain how and where auroras occur in the atmosphere. #7 Describe the interaction between the at...
A: An atmosphere is a layer of gas that surrounds a planet and is kept in location by the gravity of th...
Q: Question- 10 examples of how parasites occupy multiple habitat in sequential succession.
A: In environment, the term habitat sums up the variety of assets, physical and biotic elements that ar...
Q: In the lifecycle of an angiosperm, male pollen is produced in the ______ and is transferred to the _...
A: Introduction :- Vascular plants are angiosperms. They have stems, roots, and leaves, among other thi...
Q: Activity 2: Write the probable causes for the creation of the Global Aliance for vaccines and Immuni...
A: The GAVI Alliance is a global health partnership of public and private sector organizations dedicate...
Q: What is the effect when xylene is not removed when staining? What is/ are the specific action/s of...
A: Staining is a procedure in which the coloured dye or a stain is added to a specimen so that it may b...
Q: Using the letter T to represent the trait, what is the genotype for individual 7?
A: The correct answer to this question is: D. It is impossible determine from this picture.
Q: Instructional Technology Subsidy U.. DISMISS MULIIPLt CHUILE Why do males tend to inherit more sex-l...
A: Introduction:- A pair of sex chromosomes, XY in men and XX in females, determine biological sex in h...
Q: Insights with the stem cell 10 sentences.
A: Studies have found that stem cell treatment can assist with upgrading the development of new improve...
Q: As the cell thickness increases, the intensity of the transmitted light also increases. Is this True...
A: INTRODUCTION Thickness and intensity of transmitted light is inversely proportional.
Q: QUESTION 3 Human papillomavirus or better known as HPV is the most common sexually transmitted virus...
A: Introduction: Immunity is an ability of a host cell to fight against the diseases causing organisms,...
Q: In pea plants, purple flower color is dominant over white flower color. If you had a purple flowered...
A: Trait is a characteristic feature unique to a particular individual . A monohybrid cross is a cross ...
Q: Jurse O'Riordan has to give ceftriaxone to a 5-year old weighing 18 kg. The recommended dose is 100 ...
A: The dosage of Ceftriaxone should be given is 1.8grams.
Q: The cellular membrane is often called the fluid mosaic model. To what does this refer? 1. The fluidi...
A: Cellular membranes are composed of two layers of phospholipids.
Q: Describe and compare (advantages and disadvantages) of TWO methods to determine oxygen absorption ra...
A: Fermentation process can be observed in the environment on a daily basis.(Example: Fermentation by l...
Q: How does your excretory system help you maintain homeostasis when you are dehydrated? 2) Structu...
A: The kidneys can regulate water levels in the body; they conserve water if you are dehydrated, and th...
Q: Which of the following protists photosynthesize? Group of answer choices Autotrophs Heterotrophs Mi...
A: According to the question, we have to find out which of the following protists can photosynthesize. ...
Q: What significance do BRCA1 and BRCA2 have in regard to developing cancer, and what types of cancer a...
A: BRCA 1 & BRCA 2 are found pair in all the organisms where one gene is obtained from each of the ...
Q: Which of the following statements is NOT TRUE about tissues? A. The extracellular matrix of blood ti...
A: Cells are the basic structural and functional unit of life. These cells combine to form the tissues....
Q: HOW CAN SLEEP AFFECT ACADEMIC PERFORMANCE
A: Sleep Sleep is a natural occurring process of many organisms including humans.
Q: Plants have 3 systems for photosynthesis. Which one takes in CO2 at night, stores it, and then does ...
A: It is widely known fact that CAM pathway captures CO2 from stomata at night and fixes it during the ...
Q: Why is the cardiac action potential propagated more slowly in an AV node cell then in an atrial or v...
A: Cardiac action potential It refers to the short alteration in the voltage i.e. membrane potential a...
Q: Does resulting daughter cells in mitosis and meiosis will have identical features with their parent ...
A: Answer 1- No. Meiosis is the process through which daughter cells are formed in sexually reproducing...
Q: 4. O 1:27-Coronary Artery How is the coronary artery identified on the sheep heart? 5. O 1:47- Right...
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which...
Q: Which of the following were key innovations that allowed plants to survive on land and not dry out? ...
A: Introduction Plants are mostly photosynthetic eukaryotes belonging to the Plantae kingdom. Historica...
Q: Question 7. A channel that opens in response to the binding of a specific molecule, which is usually...
A: Introduction :- Ion channels that are activated by changes in the electrical membrane potential arou...
Q: Why are men more prone to hemophilia than women? Elaborate.
A: Hemophilia is a disorder related to blood that causes blood to clot improperly. A deficiency of coag...
Q: Many connective tissues like cartilage, ligaments, tendons skin dermal layers secrete an extra cellu...
A: Connective tissue is tissue that supports, protects, and gives structure to other tissues and organs...
Q: PActivity 2 Direction. Match column A to column B. A B 1. Luteinizing normone (LH) 2. Follicle-Stimu...
A: The chemical messengers that are secreted directly into the blood, which carries them to organs and ...
Q: Is the autoclaving process absolute in killing all microorganisms? If not, what are the factors that...
A: Autoclave is an instrument or device which is used in method of moist heat sterilisation; while pre...
Q: Briefly describe the differences among plantigrade, digitigrade and unguligrade in terms of their ad...
A: Plantigrade : In this Humans and Bears put the whole feet on the ground for locomotion. Digitigrade ...
Q: what is the interaction between tricyclic antidepressants (TCA) and antihistamines when taken togeth...
A: Antidpressant drugs are those drugs which are used to treat depression;anxiety disorders etc.various...
Q: Modern biotechnology started with the discovery of A the structure of cells B the antibacterial prop...
A: All living beings have cells, which are the most basic fundamental unit of life. Cells are responsib...
Q: Consider this chemical equation: Catalase 2H,02 2H,0 + O2 Hydrogen Water Oxygen peroxide What is the...
A: Answer : Catalase
Q: Small bristle-like structures used by bacteria for movement are: O flagella O cytoskeleton O cilia O...
A: Answer : Flagella.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- 3. Animation 12.1: This table shows results from allele-specific oligonucleotide hybridization analyses conducted on three different patients. The analyses all used the same probes constructed to test for the presence of a mutant gene. A plus sign (+) indicates hybridization occurred and a negative sign (-) indicates no hybridization occurred. Patient #1 Patient #2 Patient #3 Probe for normal allele Probe for mutant allele Which patient(s) is/are homozygous for the mutation and which patient(s) is/are heterozygous for the mutation? O Patients #2 and #3 are homozygous and Patient #1 is heterozygous for the mutation. O Patient #2 is homozygous and Patient #1 is heterozygous for the mutation. O Patient #1 is homozygous and Patients #2 and #3 are heterozygous for the mutation. O Patient # 1 is homozygous and Patient #2 is heterozygous for the mutation.Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation la: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration. Agarose gel concentration: Time: Voltage: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one) Brown sample: 0 Blue sample: 1 2 more than two. 1 2 more than two. le: If the student is homozygous for the blue allele, how many bands will they see in the lanes for the blue and brown allele…6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土
- Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the nucleus short pieces of DNA that flank most genes segments of DNA cut by restriction enzymes small DNA sequences that are repeated consecutively a few times to many times O pieces of DNA that can move through the genome by transposition How are microsatellites used in genetic studies? to identify individuals within a population used as markers in the sequencing of the human genome to identify genetic variants in genome-wide associations studies to test if a population is in Hardy–Weinberg equilibrium to transfer genes between organisms O O6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'STR markers: are point mutations detectable by DNA sequencing are variations in the number of repeats of very short DNA motifs (2-10 nucleotides) □have high polymorphism are mutations leading to proteins or blood groups that can be differentiated by antigenic testing from a blood sample ☐have low polymorphism no correct answer are changes of a few nucleotides leading to the absence or presence of a site recognized by a restriction enzyme are variations in the number of repeats of medium-sized DNA motifs (10-100 nucleotides) can be located in coding sequences are located exclusively on autosomes
- True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.(i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAATTGT TA T CCGC T CA CA AT T C CACA CA A CATA CGAGC CGGAAG CA TA A 110 120 130 140 150 160 (ii) An allele of a gene has the following change in it's sequence ATG GTG CÁC CTG ACT CCT GTG GAG AAG TCT compared to the wild type ATG GTG CAC CTG ACT CT GAG GAG AAG TCT With reference to the sequence; there is a codon, resulting in a change from is a mutation in the to which mutation.In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
- 27. Given the following plasmid map, list how many fragments would exist and their bp length when treated with Hindll and Nde1 Dail 91 Ben BI 51 EstAPI 179 BemBI 2683 Ndel 183 Kasl - Narl - Sfol 235 Bgll 245 Fspl 256 Pul 276 EcoO1091 2674 Aatll - Zral 2617 BiM 2542 Sspl 2501 Prull 306 Benrl 364 Acll 2297 BæAl 387 Apol - EeoRI 396 Xmnl 2294 lacza haall - Sacl - Ecos3KI 402 Accbs1 - Kpnl 400 Awal- BsoN - Smal- TapM I- Ymal 412 Beal 2215 MCS Scal 2177 haml 417 Xhal 0 Pvul 2066 Accl - Hinl - Sall 29 pl. Alau a sb 434 Avall 2059 PUC19 2,686 bp BerDI 1985 Sphi 441 Hindi 447 Acll 1924. Fspl 1919 Prull 628 Avall 1837 Til 641 EsaXI 659 me AllI 1822 Rgll 1813 Bpal 1784 BSPOI - Sapl 683 BsrFl 1779 Bsal 1766 Thl 781 AII - Peil 806 BerDI 1753 Dal 908 Bmrl 1744 ori Aldl 1694 BkiM 1015 BseYl 1110 AlwNI 1217 BeeN 1292 dyA cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHISal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR