True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs
Q: Why the concept of a DNA library is still important for a number of modern applications ?
A: A DNA library can be described as the collection of DNA fragments that are kept and propagated in a ...
Q: How does temperature influence the manufacture of substances, their reuse for respiration, and have ...
A: Plants utilize the process of photosynthesis to manufacture substances, generally food. During this ...
Q: Describe the method of preparation of planting material for Ginger and describe how it can be propag...
A: Introduction Ginger (Zingiber officinale) is a plant native to Asia, it is a flowering plant whose r...
Q: Explain the Molecular Techniques for Analyzing DNA ?
A: DNA is a double helical structure that is present in the nucleus of the cell. This DNA contains the ...
Q: In which specific area in the leaf does the dark reaction occur? In what area do the light reactions...
A: Light reaction is the process of photosynthesis in which the sunlight energy is converted to ATP and...
Q: Name the two (2) different varieties of Ginger and describe two (2) characteristics of each
A: * Zingiber officinale belongs to Zingiberaceae family is known as ginger. *Ginger a flowering plan...
Q: How to calculate the percentage of phage that was filtered using a 0.45 um filter? PFU rep 1- 121 P...
A: Bacteria growing on MF-Millipore filters (thickness, 150 micro m) passed through the underlying memb...
Q: Use the figure showing the glaciological year to outline how increasing average temperatures impact ...
A: Pressure melting point is defined as the temperature at which ice begins to melt under a given amoun...
Q: Explain America’s “class” bias in which the amount of money a middle class makes affects how they ar...
A: While an income-based definition of middle-class relies on the money coming into a household from a ...
Q: Analyze the graph and identify some factors that may contribute to the rotifer population leveling o...
A: Rotifers are widely distributed and can be seen in the sea and fresh waterways all over the world.
Q: In February the WHO reported several cases of farm workers being infected with the bird flu influenz...
A: H5N8 - The H stands for one of the 16 different hemagglutinin proteins contained in a virus that all...
Q: Q1: Why are E.coli cells subjected to heat shock induction when the optical density of the bacterial...
A: 1. The heat shock response is induced as a consequence of a rapid increase in sigma32 levels and sti...
Q: In Drosophila, sepia eyes (se), curled wings (cu) and ebony body (e) are found, in this order, on ch...
A: If genes are located on the same chromosome then they are known as linked genes. In this condition t...
Q: What is the difference between renewal and nonrenewable resources? How important is it in business? ...
A: The vast majority of natural resources, such as coal and petroleum, were created millions of years a...
Q: Draw a diagram illustrating a bacterial CRISPR locus. Label your drawing with a brief description of...
A: CRISPR is a family of DNA sequences that can be found in the genomic section of the prokaryotic orga...
Q: Estimate the number of hominin species that have existed in both robust and gracile clades of evolut...
A: Researchers have narrowed down on the fact that based on the number of unearthed fossils, there were...
Q: Discuss how qPCR, DNA microarrays (DNA chips), and RNA- seq analysis are used to compare levels of g...
A: The functions of a gene can be studied by looking at how it expresses in a specific cell and how it ...
Q: In the light reactions of photosynthesis, an electron is taken from causing the formation of The enz...
A: Photosynthesis is the process that produces organic molecules from simple inorganic molecules from t...
Q: a. During prophase I, the homologues come together and exchange genetic material. Now the inherited ...
A: Prophase 1 is the first stage of first meiotic division. It is a very significant phase of meiosis a...
Q: What best describes the amoebas division?
A: A single parent is involved in this Mode of asexual account, which is one of the most common types. ...
Q: explain transcriptional stages such as initiation, elongation, and termination. In this article, ple...
A:
Q: Are there ribosomes in a plant cell?
A: Yes, ribosomes are found in both plant and animal cells, and they function in the same way. Yes, you...
Q: Forests take in carbon dioxide from the air, thus it is called “carbon dioxide sinks” or “carbon sin...
A: Carbon dioxide sinks are the storage systems which hold most of carbon dioxide in our world These ...
Q: A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves with...
A: A plasmid is a small extrachromosomal DNA molecule that exists in a cell and is physically distinct ...
Q: What is Denaturation ?
A: Introduction :- Many of the weak connections, or bonds (e.g., hydrogen bonds), inside a protein mole...
Q: Question # 17 What are living and nonliving reservoirs?
A: Introduction In this question we will discuss about the living and non-living reservoirs.
Q: What best describes the amoebas division?
A:
Q: What is the advantage of the C4 photosynthetic pathway as compared to the conventional C3 pathway? H...
A: Introduction: Photosynthesis is the process of preparing food in the presence of sunlight and chloro...
Q: Consider a mutant hepatocyte cell in which the Q-cycle was not used and teh two electrons from ubiqu...
A: Electron Transport Chain Electron Transport Chain or ETC is a series of proteins that creates a pro...
Q: See attached. What effects do these problems create on the ecosystem?
A: 1. If there is improper waste disposal than it can affect the soil fertility as well as it can emit ...
Q: Why do implantable defibrillators require far less power on their own than a pacemaker?
A: Pacemaker is known as artificial heart which is incorporated of any problem in functioning of the he...
Q: The normal vaginal microbiota is usually dominated by D a variety of lactobacilli O Gardnerella O Ca...
A: Microbes are organisms that are too tiny to see without a microscope, such as bacteria, archaea, and...
Q: "Specific Genes Can Be Recovered from a Library by Screening". Describe about this ?
A: The genes can be referred to as the basic unit that can be transferred from parents to the next gene...
Q: In Figure 12-11b, in what chromosomal region are youlikely to find the most H1 histone protein?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: 3. The laboratory technician dilutes her sample serially 1:10 and plates the following dilutions: 10...
A: The technician dilutes the sample in 1:10, 1:100, 1:1000, 1:10000, 1:00000, 1:1000000 dilution seria...
Q: Describe at least one important application of DNA technology in each of the following fields: medic...
A: These days, DNA-based technology is very common. Biotechnology is the process of manipulating living...
Q: Explain the Molecular Techniques for Analyzing RNA ?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: In making red blood cell suspension, why do we need to wash red blood cells in saline?
A: Red cell suspension is a common reagent used for many serologic procedures. Red cell suspensions pro...
Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single stra...
A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule i...
Q: Differentiate the patterns of biodiversity? (Spatial pattern of biodiversity and Temporal pattern of...
A: Answer Spatial and temporal pattern of biodiversity :
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is s...
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the...
Q: Which of the two molecules from seventh step of glycolysis, 1,3 Bisphosphoglycerate or 3-Phosphoglyc...
A: Embden Meyerhof Pathway - Glycolysis. The sequence of reactions by which glucose is degraded anaerob...
Q: Describe some mechanisms of antibiotic action and antibioticresistance
A: Antibiotics:- The word Antibiotics consists of two words "anti" and "biotics" which means against li...
Q: QUESTION 5 Match the term to the correct description. + Blastomeres A. Small cells formed during cle...
A: Match the term to the correct description.
Q: Differentiate motor nerve ending and sensory nerve endings? Explain briefly and be direct to the poi...
A: The nerves which carry information from Central Nervous System(Brain and spinal cord) to Peripheral ...
Q: Explain the importance of thermostable polymerase used for PCR ?
A: Introduction: Biotechnology is a discipline of science concerned with the use of biological methods ...
Q: How new sequencing methodologies are replacing traditional genomic DNA libraries ?
A: The term genomic DNA library is associated with DNA fragments collection comprising an organism's wh...
Q: What are thermocyclers ?
A: Introduction Polymerase chain reaction (PCR) is a widely used method for rapidly producing millions ...
Q: Why are cellular respiration and photosynthesis thought to be cyclical reaction? Think about the pro...
A: Introduction Cellular respiration is what cells do to break up sugars to get the energy they can use...
Q: How does doing a Dichotomous key influence one's decision-making when it comes to sorting or recogni...
A: Dicotomous key is based on the characteristics of the organisms which is needed to be identified. Th...
Step by step
Solved in 2 steps
- How many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type IIl restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. 1 2. 4. 5.Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHICoding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
- Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?1. Briefly explain why the total size of the pMBBS plasmid in the Restriction Enzymes practical is 3000bp (base pairs) 2. Briefly explain why the cut sites on the pMBBS plasmid in each Restriction Enzymes (EcoRI, BamHI, and XhoI) just 1 each 3. Briefly explain what led to the 5 fragments formed which linked to the 500bp, 1000bp, 1500bp, 2000bp, 2500bp sizesTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.
- Explain your experimental approach if you must correct the genetic defect phenylketonuria, which is caused by mutations in the phenylalanine hydroxylase gene using the CRISPR/Cas9 system and homology directed DNA repair.A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI2. You are planning to clone a gene into the PBR322 plasmid vector. The gene has Bgl II restriction enzyme sites on both the 5' and 3' ends. Restriction enzyme Recognition site 5'... CTGCAG...3' 3... GACGTC... 5 5... GAATTC...3' 3:... CTTAAG. ECORI Hindil Pst I BamH Eco RI 5' Tetracycline Resistance Hind III 5...AAGCTT...3' PBR322 (4.36 kb) Xmalll 3...TTCGAA ... 5' 5... GGATCC...3' 3... CCTAGG...5' 5...CCCGGG...3° 3...GGGCCC ... 5 5... A'G ATCT...3 3... TCTAGA... 51 Bam HI Origin Replication Xma l BglI E. coli PBR322 plasmid showing restriction sites and resistance genes. Pvull With which restriction enzyme would you cut the PBR322 plasmid vector? Give a reason for your answer. You assemble a ligation reaction to join the gene to the plasmid DNA. What types of product would you expect to obtain from the ligation reaction? Please consider the selection marker genes, Ampicillin resistance gene and Tetracycline resistance gene. What would the antibiotic resistance phenotype be of a…