Q: Pt is a 81 y.o female with history of schizoaffective disorder, tardive dyskinesia, CAD, oxygen…
A: Hypertension, commonly known as high blood pressure, is a chronic medical condition characterized by…
Q: what are example of proper rotational grazing. 2. what ways in which degraded areas can be treates…
A: Rotational grazing includes sequentially rotating animals across different pastures or grazing…
Q: Explain why people with Medium-chain acyl-CoA dehydrogenase deficiency are advised to eat a diet…
A: People with Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency are advised to eat a diet rich in…
Q: Genetically modified Atlantic salmon have recently been approved for human consumption. These…
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) refers to a specific DNA sequence…
Q: Pax-6 is a gene that is involved in eye formation in many invertebrates, such as Drosophila. Pax-6…
A: Genes are the units of heredity, in other words, we can say genes are the short nucleotide sequences…
Q: 1) Trypanosomes living in the bloodstream obtain all their energy from glycolysis. They take up…
A: Trypanosomes are unicellular parasitic protozoa that belong to the genus Trypanosoma. They are…
Q: Question 4 RNA editing in coding regions can result in changes in the protein sequence. O True O…
A: RNA stand for Ribonucleic Acid. It is a molecule that is essential in many biological processes,…
Q: E. coli K12 genomic DNA (expected PCR product was 3075bp). For expression the gene was cloned into…
A: The information you provided suggests that a gene was cloned into the expression plasmid pET28a, and…
Q: Which of the following is true of two loci that do not show any recombination? a Their physical…
A: When there is no recombination between two loci, understanding this link can help us better…
Q: If there were two distantly protein, the best BLOSUM & PAM matrix is
A: These two BLOSUM and PAM matrix are substitution matrix. When in a sequence one character is…
Q: The question mentioned structural formulas. How does this reaction look in that format?
A: The activation and oxidation of a 7-carbon fatty acid within the liver contain several steps and…
Q: Cape parrots are found in forests in South Africa. In a study of Cape parrot genetics, biologists…
A: Cells of an individual species that participate in the process of reproduction are known as gametes.…
Q: OA. The myogenic response is an extrinsic mechanism that regulates blood flow in response to changes…
A: Myogenic response is the mechanism by which arteries and arteriole react with the increase or…
Q: Here is a second human gene, called cxx3. The structure indicates the following: the start and end…
A: RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a molecular technique commonly used to…
Q: Albinism is rare in most human populations, occurring at a frequency of about 1 in 20,000 people.…
A: An allele is a variant form of a gene that exists at a specific location on a chromosome. Genes are…
Q: You have several different media onto which you inoculated eight strains of yeast (A-H). The media…
A: Minimal medium (unsupplemented) A minimal medium is a growth medium used for growing microbes and…
Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…
A: Gene is present on a chromosome and contains hereditary information. These genes are later…
Q: "Genes and alleles are the same thing." Please explain in detail why this is false and a…
A: The statement "Genes and alleles are the same thing" is a misconception that requires clarification.…
Q: A synthetic biology research team successfully created a new organism in the lab. Which of the…
A: Synthetic biology is a rapidly evolving field that involves the design and creation of new…
Q: Sometimes longer isn’t better. Easy, concise descriptions and explanations are useful when a doctor…
A: Prostate cancer is a type of cancer that develops in the prostate gland, which is a small…
Q: Describe the hormonal events which initiate milk secretion and maintain its production.
A: Prolactin is the primary hormone responsible for milk production. It is secreted by the anterior…
Q: The _____ is the primary muscle of ventilation at REST. Group of answer choices…
A: In normal ventilation at rest, there are small inhalation followed by small exhalation. Inhalation…
Q: Discuss the hormonal changes and the timing of parturition.
A: Parturition, also known as childbirth or labor, refers to the process of delivering a baby after the…
Q: Describe the development of the mammary gland and the differences between various species
A: The mammary gland is an organ found in female mammals that produces milk to nourish their young. The…
Q: Hartnup disease is an autosomal recessive disorder of intestinal and renal transport of amino acids.…
A: A characteristic, illness, or disease can be handed down through families in a number of different…
Q: Do anthropologist considered gender as continuum?
A: When the idea of a gender continuum first came into existence, it provided a more sophisticated…
Q: 3. The human genome contains about 20,000 genes but human cells can synthesize about 80,000…
A: The human genome is made up of both coding and non-coding regions. The coding regions, also known as…
Q: Version2: • What two organ systems are prominent in this model? • How does organ system A interact…
A: An essential component of biological and medical research is comprehending the intricate…
Q: 6a. C. elegans display a very characteristic sinusoidal movement, like a snake slithering. Imagine…
A: The movement of C. elegans, resembling a sinusoidal motion, is a distinct characteristic of these…
Q: In a population of 235 individuals, it was observed that 200 were found to be (AA), 30 were found to…
A: Finding the frequency of the (A) & (a) alleles:
Q: The karyotype at right is from which of the following animals? a b C Selected answer will be…
A: The genetic material of an organism is the DNA which remain condensed in the form of chromatin in…
Q: 22. Which of the following would be considered part of an emerald tree boa's ecological niche?…
A: Humans are not a natural part of the emerald tree boa's ecological niche. Ecological niches refer to…
Q: A cell's normal surface area:volume ratio (SA:Vol) is 3:1. As a rest of unusual uptake of water, it…
A: When a cell takes up an unusual amount of water its volume increases causing a decrease in its…
Q: Describe the events that must occur within the transfected Sf9 cells (in vivo) between the transfer…
A: The production of a recombinant Bac-n-Blue viral genome involves a series of events within…
Q: Why is the evolution of the amniotic egg significant? Embryos are protected from predators.…
A: An amniotic egg is an egg which is terrestrially adapted egg and encased by a shell and…
Q: The evolutionary history of a species or group of species is known as its ____________________ and…
A: The term "species" refers to the fundamental unit of biological classification in the field of…
Q: what is an example of a sensory neuron being changed by external physical stimulation?
A: A sensory neuron, also called an afferent neuron, is a type of nerve cell that transmits sensory…
Q: The oestrus cycle refers to: (select one) a. The cyclical occurance of physical and endocrine…
A: Throughout the oestrus cycle, numerous animals can display distinctive traits and behaviours, which…
Q: e. Mark the chromosome alignment (spindle) checkpoint
A: E. Check are present a different stages in the cell cycle so that the separation of chromosome…
Q: Draw a ribosome translating a protein from an mRNA template. Label the parts! Where is this…
A: Translation: The process of translating the information encoded in the mRNA molecule into a…
Q: Contrast the sources of nutrition between the pre and post implantation conceptus.
A: Implantation is a crucial event in embryonic development that occurs after fertilization. It…
Q: An atretic follicle.... (select one) a. Is degenerating b. Is one of the very few which reaches…
A: At birth, there are 500000 to 10000000 follicles. Out of which only 1% of the follicles ovulate…
Q: are you sure? i got a different answer
A: Skeletal muscles are striped and voluantary muscles. On the other hand, cardiac muscles are the…
Q: The steroid hormone estradiol has a negative feedback effect on LH and FSH secretion. However, it…
A: Ovulation is the process in which a mature egg is released from an ovary. It usually happens about…
Q: The Delacour family is descended from the Veela race, a semi-human, semi-magical humanoid people…
A: Being a Veela is X-Linked Dominant trait. In X -linked dominant inheritances one affected X allele…
Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…
A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…
Q: Which of the following statements best describes diseases of the thyroid gland?…
A: The thyroid gland is a small, butterfly-shaped endocrine gland located in the front of the neck,…
Q: 1. The statement "DNA goes to RNA goes to protein" is used as a shorthand description of the flow of…
A: a. "DNA goes to RNA" is meant to describe the process of transcription. For this process to occur,…
Q: Be able to describe cyclic slow waves in terms of timing and their strength.
A: Cyclic slow waves refer to rhythmic patterns of electrical activity that occur in biological…
Step by step
Solved in 4 steps
- Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? GGTAACC CCAATGG GGTTACC CCATTGGacconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR ImmunizaWhat is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis profile from the Sanger sequencing method? ddATP ddCTP ddGTP ddTTP
- TRANSCRIBE this DNA sequence: TACGTTACT AUGCAAUGA O ATGCAATGA AUGGATUGA TACGTTACTSecond Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third BaseSample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and then the resulting DNA fragments are run on a gel next to each other. DRAW THE BANDS on the gel where theywould appear: • Carissa's DNA was cut into 4 pieces: 2- The pieces were 20 base pairs long, 10bp long, 8 and 5. 4- • Christopher's DNA was cut into 5 pieces: 6- They were 25 bp long, 10, 8 and the last two pieces were 8- koth 2 be long. 10 You can make a scale to helo you > 12 14 13. What did you do about the 2 DNA fragments that were 16- 18- both 5 base pairs long? 20- 22 24- 26 14. How many DNA fragment sizes do these kids have in common? Both the kids have two fragments similar. 8bp & 10bp I O 00 O 00 Carissa Smith Christopher Smith
- BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI HindIII 625 2150 HindIII 700 PstI clal 750 РКАВОО 2700bp 915 1900 SpeI AluI 1050 1525 BamHI ori You wish to make a recombinant DNA molecule that will contain one piece of pKABOO vector DNA and one piece of frog DNA so that you can clone a segment of frog DNA. You want cells containing your recombinant plasmid to be amp' and tet and you want to use enzymes that cut within the insertional marker gene. (Note that tet means that there is no functional tet gene in the plasmid.) Be sure that your plasmid has the ability to replicate autonomously in a bacterial cell. You do not have to include the entire frog DNA given below in your recombinant plasmid. Restriction enzymes would be used to clone segment of frog DNA The size of the recombinant plasmid is bp. The recombinant plasmid when transformed into E. coli confers resistance to which of the following antibiotics: Oampicillin only Otetracycline…PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…What is the relationship between fluorescence intensity of a spot and the amount of DNA in a sample for a Virochip DNA microassay? From the following which is the best choice Less DNA results in greater fluorescene since the laser passes through he sample eaiser More DNA equals to more intense fluorescence since the DNA makes a layer to refelct the laser light More DNA equals to more intense fluorescence since of more dye on the DNA is fluorescene More DNA results in to more fluorescence since there's more DNA to be excted by the laser None of the above
- What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis profile from the Sanger sequencing method?Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dnaWhich of these is not a tool for comparing DNA sequences? BLAST Fasta PLINK A dotplot e.g. dotlet