Q: Animal kingdom mind map
A: All creatures on Earth are classified under the taxonomic category of the animal kingdom.
Q: 7) What hormone is produced during long-term stress? a) FSH b) LH c) ACTH d) norepinephrine
A: A hormone is a chemical substance produced and secreted by glands in the endocrine system that…
Q: Differentiate extraembryonic and intraembryonic coelom in terms of location in embryos. Provide…
A: Coelom It is defined as the main body cavity present in most organisms. It is the mesodermally lined…
Q: In humans, miRNAs are thought to regulate the expression of at least one-third of all protein-…
A: RNA (Ribonucleic acid) is a single-stranded nucleic acid that is present in all living cells. It is…
Q: Using standard nomenclature, what would be allele number assigned for the following? AGAT AGAT…
A: An allele is the alternate form of the genes, responsible for coding different versions of a…
Q: Explain why you alternately feel cold and shiver followed by feeling hot and sweating when you have…
A: The rise in a person's core body temperature above a "set point" controlled by the hypothalamus, the…
Q: what are the factors affecting yeast diversity in marine environment and factors affecting seaweed…
A: Areas, where the reconciliation is done to conserve biodiversity and its sustainable use, are called…
Q: Which of the following is a useful serum marker for the diagnosis of prostate cancer? Select one: A.…
A: In males, the prostate is a little walnut-shaped gland that is responsible for the secretion of the…
Q: What is the difference between anabolism and catabolism
A: Metabolism is the process by which various chemical processes take place in an organism or a cell.…
Q: G.H. Hardy and Wilhelm Weinberg created the Hardy-Weinberg principle, which states that a population…
A: Evolution is the process of gradual change in the inherited traits of a population over successive…
Q: Give typing answer with explanation and conclusion In 1-2 sentence(s) describe one trait/adaption…
A: Brook trout, also known as squaretail, or speckled trout, is a type of fish that comes under the…
Q: 1. Circle the bonds in the drug molecule below that could be hydrolyzed by metabolic enzymes. OCH₂…
A: When an enzyme uses water to break a complex molecule into simpler substances then this process is…
Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'
A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…
Q: What information from the pet food manufacturer, distributor or trader should be found on the label?
A: Pet food labels are required to provide important information to help pet owners make informed…
Q: please answer with explanation and use text format as much as possible do not copy, thanks Draw…
A: Lipids are a diverse group of biomolecules that are primarily hydrophobic and include fatty acids,…
Q: outline and describe the impact of Charles Lyell's work on the development of Charles Darwin's…
A: Charles Lyell was a geologist and a contemporary of Charles Darwin whose work on geology had a…
Q: what diffulcitie one encounter when trying to differentiate bacteria on the basis of physiological…
A: Laboratory procedures called physiological tests for bacteria are used to ascertain the metabolic…
Q: The above product water molecules are generated in which eukaryotic cell compartment?
A: The question asks the location where water is produced in case of eukaryotic cells. We will find out…
Q: 1. Null vs Alternative Hypothesis • Definition & connotations • How do they differ? • How do you…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: a group of three nucleotides codes for one amino acid. these groups of three nucleotides are called…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain an amino…
Q: 79. Which of the following descriptions is correct, regarding to O-linked and N-linked glycans? (A)…
A: Polysaccharide chains made up of repeated disaccharide units are known as glycosaminoglycans (GAGs).…
Q: Which of the following is a cause of cryptorchidism? Select one: A. Testicular cancer B. Infertility…
A: The question is asking about cause of the cryptorchidism, a condition in which one/both testicles…
Q: i 2. Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of…
A: GAL1 transcription is the mechanism by which RNA polymerase II in eukaryotic cells converts the GAL1…
Q: In Drosophila, a female with three recessive traits, miniature wings, (m), ebony body (e) and rough…
A: This question is about a genetic problem involving the inheritance of traits in Drosophila flies.…
Q: 1which test is used to differentiate between fermentative and oxidative metabolism?describe the…
A: 1.The test used to differentiate between fermentative and oxidative metabolism is the…
Q: What is one way that CD8+- cells are activated? A. by binding to a processed antigen on an MCH II…
A: White blood cells called CD8+ T cells are also referred to as cytotoxic T cells. These cells are…
Q: . Humans do not have the ability to digest fibre. If humans had the ability to digest cellulose,…
A: Biomolecules such as carbohydrates, lipids, proteins, etc. are essential for sustaining life.…
Q: Is the concept of infectious dose applicable to Covid -19 infections? Why/Why not?
A: The "infectious dosage" is the quantity of a pathogen needed to cause an infection. It is improbable…
Q: the principles behind biochemical testing, identifying examples.
A: Biochemical tests are generally used to study the biochemical properties of microorganisms. These…
Q: What percentage of the potential FEMALE offspring will be colorblind? 0%
A: Genetic disorders arise due to mutations or deletions in the DNA that results in the production of…
Q: Cells are made competent by treatment with CaCl2 O heat shock O treatment with recovery broth O…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Do the terms 'closest evolutinary relationship" and most common ancestor" alike
A: Biology core subject is to study the organismal evolutionary relationships. To ascertain the links…
Q: 68. Which of the following is a characteristic feature of the base (posterior third) of the tounge?…
A: A muscular body part called tongue is crucial to speech and taste perception. It is divided into…
Q: Research both arguments regarding the safety of GMO use in foods. Based on the evidence, are GMOs…
A: GMO refers to a genetically modified organism, it is any organism i.e., plants, animals or…
Q: 1) The olfactory receptor neurons in frogs resemble those of mammals, in that they express olfactory…
A: We can see in the data in the chart given in the question that the binding of an odorant molecule to…
Q: A strain of Shigella has a mutation causing it to lose the ability to produce fimbriae and become…
A: Shigella is a type of bacteria that causes shigellosis, a common bacterial infection that affects…
Q: The baroreceptors that detect a change in blood flow to the brain belong to a family of receptors…
A: Baroreceptors are specialised sensory receptors found in the carotid sinuses and aortic arch of some…
Q: When top-down control occurs within an intertidal zone along the rocky coastline of the Pacific…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: 1. Explain BRIEFLY whether each of the following conditions will increase or decrease the chance of…
A: Note:- Since you have posted a question with multiple subparts, so we will be solving the first…
Q: Which sex hormone is most associated with beard and hair growth? a. Estrogen b.…
A: Sex hormones are hormones that are responsible for the development and regulation of the…
Q: Triacyl glycerols can be hydrolyzed under basic conditions to give ________ (a 3 carbon compound)…
A: Triacylglycerols are formed by linking fatty acids with an ester linkage to three alcohol groups…
Q: Which statement best describes the diagrams shown? https://images.app.goo.gl/
A: Cell division is a process in which cell elongates and divides into two daughter cells. It is very…
Q: Which of the following is TRUE about mechanoreceptors? O Activation of mechanoreceptors activate…
A: Mechanoreceptors are sensory receptors that react to pressure and stretching, and bending that are…
Q: 9) The the function. and the of amino acids determine the shape of proteins, while the a. property,…
A: Proteins are vast and complex molecules that are required for the normal functioning of living…
Q: In an experiment that tested eye muscle reaction time based on a physical stimulus, 12 subjects were…
A: The amount of time it takes for the eye muscles to react to a visual stimulus is known as the eye…
Q: uestion 17. Primers are designed to span introns or bridge an exon-exon junction to avoid genomic…
A: Reverse Transcriptase Polymerase Chain Reaction,l or RT-PCR is a frequently used method in molecular…
Q: Why is it not necessary to include a caloric content statement on the information panel
A: "Calorie" is defined as the "energy" of a food product. It is a unit of measurement that defines how…
Q: bulb-urethral gland corpus cavernosa corpus spongiosum ductus deferens external urethral orifice…
A: The male reproductive system refers to the organs and glands of the male that are essential in…
Q: Which of the following properties is shared by all stem cells? Select all that appl Totipotency…
A: Stem cells are cells that have the ability to self-renew and differentiate into various cell types.…
Q: D Question 5 The main goal of utilizing the RNA-seq technique is to generate a: genome annotation.…
A: RNA sequencing (RNA-seq) is a high-throughput technique that is used to analyze the transcriptome of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of these organisms is NOT in the clade Lophotrochozoa? Cephalopoda Gastropoda Bivalvia C Platyhelminthes O MyriapodaWhich of the following is/are true of Nemertea partitioned coelom. eversible proboscis blood vascular system OrhynchocoelThe class of annelid worms which differs from all other classes of annelid worms in that it lacks an obvious septate coelom, and possesses no setae is the: Hirudina O None of these shown here Pulmonata Polychaeta Oligochaeta Cestoda
- Which of the following has indeterminate development? Echinodermata Nematoda Arthropoda PlatyhelminthesWhat animal is this? nemertean polychaete tardigrade arrow worm phoronidWhich is an outcome associated with torsion but not with coiling? (mark all that apply) potential fouling of the gills lack of a coelom unbalanced weight-distribution in the shell the production of a blind gastrovascular cavity retraction of the ciliated, larval "swimming organ"
- The only class or group of Annelid worms which possesses a permanent clitellum is the: Hirudina Cestoda Oligochaeta Platyhelminthes Permoclitellata All lack a permanent clitellum PolychaetaWhich Scyphozoan life stage performs sexual reproduction? Gemmule Planula Scyphystoma Medusa EphyraWhich of the following sponge body types would have the lowest amounts of gas exchange and feeding? Synconoid Asconoid Leuconoid
- A mantle and mantle cavity are present in _____. a. class Oligochaeta b. class Bivalvia c. class Polychaeta d. class HirudineaName the animal shown in this picture. O Nematoda O Mollusca OAnnelida O Cnidaria OPlatyhelminthesWhat unifies the hexapoda? Be able to recognize a few of these classes by sight, and be able to distinguish some of them. Be able to describe specializations of different organisms. Complete metamorphosis (holometabolous) vs incomplete metamorphosis (hemimetabolous)