What type of DNA damage would you expect from UV-B irradiation (at 260 nm) of DNA that includes the sequence GCGATGCTTAGA, and how would it be detected and repaired?
Q: An enzyme catalyzes a reaction with a Km of 6.50 mM and a V of 4.45 mMs. Calculate the reaction…
A: The Michaelis-Menten equation to calculate the reaction velocity of enzymatic catalytic reaction is…
Q: protein Insulin (also see Fig 14.24) Ferritin Myoglobin Hemoglobin Ribonuclease a-keratin Collagen…
A: Insulin is a protein hormone, and its structure is quite fascinating. It's made up of two chains of…
Q: Order the following steps of muscle contraction: Drag and drop options into correct order and…
A: The action potential is initiated and propagated through the motor neurons to finally reach the…
Q: HB is a poor transporter of oxygen OHB is an efficient transporter of oxygen HB is an efficient…
A: Hemoglobin is a pigment which is present in red blood cells. It is made up of 4 polypeptide chains…
Q: Consider a uniport system where a carrier protein transports an uncharged substance A across a cell…
A: The following equation describes the mathematical relation for the change in free energy () SHAPE…
Q: Please draw a tripeptide containing (in this order) a residue with a residue with an non-polar…
A: Nonpolar amino acids do not have a charge and are hydrophobic. They are classified as aliphatic and…
Q: hat is the stoichiometry of the synthesis of ribose 5-phosphate from glucose 6-phosphate without the…
A: 5 Glucose 6-phosphate + 1 ATP --> 6 ribose 5-phosphate + 1 ADP + 1 H+This reaction is a part of…
Q: A tetrapeptide was analyzed with carboxypeptidase, the results from the analysis are found in the…
A: There are four classes of biological macromolecules- proteins, nucleic acids, lipoproteins and…
Q: Why is the citric acid cycle the central pathway in metabolism? (Select all that apply.) Citric acid…
A: The citric acid cycle, sometimes referred to as the Krebs cycle, is an important metabolic process…
Q: Estimate the number of amino acid residues in each of the two helices of a segment of the…
A: The structural configuration of alpha-keratin proteins, a class of fibrous structural protein…
Q: Draw the linear fisher projections of D-ribarnic acid, L-xyluronic acid, D-arabinuronic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: The second messenger cyclic AMP (CAMP) is synthesized from ATP by the activity of the enzyme…
A: Some signalling molecules cannot diffuse across the biological membranes so they communicate their…
Q: Which of the following is not a CYP450 catalyzed oxidation/reduction reaction? O A. deamination OB.…
A: The Cytochrome P450 (CYP450) enzymes are a group of enzymes that play a crucial role in the…
Q: Using the values of pKas in the table below, calculate the pỈ for DTLH. Properties of some amino…
A:
Q: What are the differences in atp formation in glycolysis vs oxidative met
A: ATP (adenosine triphosphate) is a critical molecule that stores and releases energy for cellular…
Q: Classify each monosaccharide according to the position of the carbonyl group and the number of…
A: For carbohydrate containing aldehyde group:Aldotriose: carbohydrate with three carbon atoms…
Q: the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) •…
A: Replication is the process in which template strand of DNA is copied into complementary strand of…
Q: The full structure for the polypeptide found in wasp venom is shown. Identify the individual amino…
A:
Q: Draw the most acidic forms of the following peptides: a. ELVIS b. LIVES c. Approximate the pI of…
A: The four types of biological macromolecules are proteins, nucleic acids, lipids and…
Q: The activity of chymotrypsin changes as the pH changes in the range of pH 5-9, as shown on the a.…
A: Chymotrypsin is an enzyme that aids in breaking down proteins within the body. It is produced by the…
Q: NaCl (s)-> NaCl (aq) is accompanied by an increase in entropy because [Select] [Select] a solute was…
A: Entropy:Entropy can be defined as the measurement of randomness or disorderness in the thermodynamic…
Q: 2. Assuming no contact inhibition and optimal nutrient and waste transport, graph the cell…
A: a. The cell proliferation rate (kp) is a measure of how quickly cells divide. A high kp value means…
Q: After exhalation of carbon dioxide, His 146 becomes in O Protonated; Increased O Deprotonated;…
A: The statement is describing the Bohr effect, which is a phenomenon where the binding of oxygen to…
Q: Provide a reasonable step-wise mechanism for the reaction below, involving TPP as a coenzyme (can…
A: Enzyme catalysis can occur via different mechanisms such as general acid/base catalysis, covalent…
Q: A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the…
A: Trypsin cleaves specifically peptide bonds at the C-terminal side of lysine (K) and arginine (R)…
Q: main binding pocket inside the GLP-1 receptor and the critical residues found in GLP-1 particularly…
A: GLP-1 receptor is glucagon-like peptide-1 receptor. It is a G-protein-coupled receptor that is…
Q: 4. Graphing the results from kinetics experiments with enzyme inhibitors The following kinetic data…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: The F₁F. - ATP synthase is a molecular machine that converts the proton motive force into enzymatic…
A: The molecular device known as F1F0-ATP synthase transforms the proton motive force into enzymatic…
Q: Match each SERCA domain to its role in Ca2+ transport: Drag and drop options on the right-hand side…
A: SERCA is an enzyme that is essential for muscular function. It is in responsible of transporting…
Q: The Lineweaver-Burk plot, which illustrates the reciprocal of the reaction rate (1/v) versus the…
A: The enzymes are biological catalysts that increase the rate of biochemical reactions.The enzyme…
Q: 14-16. List the group (nonpolar, polar, acidic, or basic) for each of the following armino acids:…
A: Amino acids are broadly grouped into polar and nonpolar. Nonpolar amino acids can be further divided…
Q: The transport would also be characterized as Aspartic acid uniform diffusion active facilitated…
A: The cell/ plasma membrane is the external protective barrier of the cell allowing movement of only…
Q: Identify the parts of the G protein shown in the image. GB C Ga O GDP Answer Bank B subunit y…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called the…
Q: In the diagram below, the orange circle represents an effector and the dark purple shapes (both the…
A: An allosteric effector, also referred to as an allosteric regulator, is defined as a molecule which…
Q: Melibiose is a disaccharide found in artichokes. It consists of galactose and glucose linked by an…
A: a) Melibiose is a disaccharide which is formed by an α- 1,6 - glycosidic bond between glucose and…
Q: In the scenario shown above, the green spheres are Glucose molecules and the blue dots are water…
A: Note:- sorry as per the honor code we are not allowed to refer to external links, However, we will…
Q: TABLE 5.1 Properties of the common amino acids found in proteins Name Alanine A, Ala Arginine R, Arg…
A: Proteins are folded peptides. Peptides of chain of amino acid residues linked together via a peptide…
Q: calculating the “Activity ([PNPP]) for each Supernatent.
A: Here we are undertaking the acid phosphatase assay. Acid phosphatase enzyme catalyzes the hydrolysis…
Q: Complete the Haworth projection of B-D-fructose. The anomeric carbon is shown. C H Answer Bank OH…
A:
Q: The cytochrome P450 family of monooxygenase enzymes are involved in the clearance of…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Draw the Fischer projections of the four aldotetroses. Draw the D-sugar on the left and its L-isomer…
A: There are four classes of biological macromolecules; proteins, nucleic acids, carbohydrates and…
Q: This question has been posted previously with parts A B and C already answered. Please focus on only…
A: Amino acids classified as hydrophobic have side chains (R groups) that have a propensity to resist…
Q: How many ATP, NADH, and FADH are formed in the krebs cycle?
A: Cellular respiration can be defined simply as a series of metabolic processes that take place within…
Q: Myoglobin has a oxygen. it 111111 Higher; transports O Lower; transports affinity for oxygen…
A: Myoglobin and hemoglobin are both proteins involved in oxygen transport, but they have different…
Q: TPCK is a molecule with large hydrophobic groups. Why does TPCK inactivate chymotrypsin but not…
A: Proteases are enzymes responsible for cleaving peptide bonds. Chymotrypsin and trypsin are both…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Aerobic respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: People are very interested in understanding how prions fold. (Prions are proteins that begin…
A: 1. To determine which protein, mouse or bovine, will be more "folded" at 310K, we need to compare…
Q: The mechanism of chymotrypsin can be viewed as a two-step process, acylation of the enzyme active…
A: A burst in rapid kinetic studies (i.e. pre-steady state studies) is a high rate of product release…
Q: PepA and PepB. Your mentor's initial studies identified a pentapeptide substrate called Tide5 that…
A: According to Michaelis-menten apporach, when the rate of an enzyme catalysed reaction is measured at…
Q: A protein contains three 60-kD polypeptides and six 20-kD polypeptides. Each 60-kD chain is…
A: Electrophoresis means migration of charged particles under the influence of an electric…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- 10. When looking at your agar plate, where are the bacteria that did not take up the plasmid during the transformation? (It is a 4 letter word). Thanks for the help!2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.10. Samples were tested for sickle cell disease by PCR. The results were analyzed by agarosc gel electrophoresis. Lanes I, 3, 5, 7, and 9 are PCR-amplified, but undigested DNA (364 bp), and lanes 2, 4, 6, 8, and 10 are Ddel-digested DNA. Lanes 1&2 are from a known carrier DNA (B^/B", 4 bands). Please, identify the genotype in lanes 3&4, 5&6, 7&8, 9&10. DNA marker 1 2 3 4 5 6 7 8 uents 10 364 bp- 291 bp- 201 bp- bp CKO BA/Bs
- 2. Replicate this strand of DNA:GCA TAG CAA TGC10. V(D)J recombination contributes to the diversity of immunoglobulins, and occurs by:A. Random single-strand nicks in the DNAB. Programmed double-strand breaks in the DNAC. Site-specific recombinationD. Homologous recombinationE. Retrotransposition 11. Zsuzanna Izsvak and coworkers set out to make a functional copy of a nonfunctional transposase in a fish that is estimated to have been nonfunctional for over 14 million years. The functional transposase became known as ____________________.A. Sleeping BeautyB. RumpelstiltskinC. PandoraD. Rip van WinkleE. None of the above 12. Which of the following Tn3 proteins catalyzes recombination to separate the donor and acceptor DNA molecules?A. transposaseB. DNA polymeraseC. RecAD. ResolvaseE. β-lactamase6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red arrow shows the direction of the primer. AAAGIACGTIGAC ATTGGCC 3' TAACCGG 5' 5' GTCCGAC 3' CAGGCAG C. 5 CAT&CAACTO a. What is the sequence of the red RNA primer? b. If the replication fork moves to the left (left side opens more), will this primer be used to create the leading strand or lagging strand? Please explain your answer. If you answered the leading strand, explain why replication is continuous. However, if you answered lagging strand explain why replication is discontinuous.
- 2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?14. What term describes this change + LYNAS age to DRZAT 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
- BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases2. Researchers were interested in a human syndrome characterized by short stature, hearing loss, premature aging and photosensitivity. Panel A shows the effect of UV on fibroblast survival. Panel B shows the effect of UV on lymphoblast replication. Panel C shows the effect of UV dose on unscheduled DNA synthesis (UDS), which is DNA synthesis that occurs at times other than S-phase. Ignore panel D. Based on these results, generate a possible hypothesis the molecular cause of this syndrome. Name one protein that could be involved and design experiment to test its involvement. Be sure to include appropriate controls. в 100 WT 0.8 P3 10 0.6 0.4 WT (L7) 0.2 L5 -L6 0.1 4 6 8 UV dose (J/m) 2 4 6 8 10 12 14 2 10 12 UV dose (J/m) 10000 140 WT 9000 120 8000 P2 7000 100 P3 WT 6000 CS P2 80 5000 60 4000 3000 40 2000 20 1000 2 4 8 10 12 10 UV dose (J/m) 15 20 UV dose (J/m) UDS/cell (AU) % Survival relative to unirradiated > % RRS relative to unirradiated O Population doublings in 72 h relative to…. I 1 I 2 I 3. I 4. I 5. L . Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TIT ATG GAC TCT ACG GAC TAA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: 2. Using the given DNA template synthesize the MRNA: 3. What is the amino acid sequence of this protein? Good to go O Focus