What Are Point Mutations? ORIGINAL DNA: JUA corresponds to the amino acid leucine FRAMESHIFT MUTATION SILENT MUTATION MISSENSE MUTATION NONSENSE MUTATION JUGA CUA GUA UAA every amino acid that follows will be altered leucine valine stop codon
Q: Identify neuroanatomical regions involved in addiction and discuss their function
A: Functions of neuroanatomical regions involved in addiction:Nucleus Accumbens (NAc): The NAc…
Q: pls make sure it’s correct and asap
A: The body maintains homeostasis through three main types of regulatory systems:Negative Feedback…
Q: Genes M and N are 8.0 map units apart on one chromosome. Genes R and S are 7.5 map units apart on a…
A: Detailed explanation:Recombination is the process by which information is exchanged between…
Q: Classify the phrases. Does each phrase describe a kinase, a phosphatase, neither, or both? Kinases…
A: The objective of the question is to classify the given phrases based on whether they describe a…
Q: Please explain what is Naegleria Fowleri and why is it so important. Also, by temperatures rising…
A: References:https://www.cdc.gov/parasites/naegleria/general.htmlhttps://www.ncbi.nlm.nih.gov/pmc/arti…
Q: 11. Foods can be preserved in all the followings except: a) lyophilizing b) Drying c) Salting d)…
A: QUESTION 11a) Lyophilizing (freeze-drying): This method involves removing water from the food by…
Q: Examine the Following key words and examples on the left. Drag the choice from the right that best…
A: Primary Succession: This occurs when a community establishes itself on a previously uninhabited…
Q: Which stage of the HIV Reproductive Cycle would be most directly blocked if reverse transcriptase…
A: If reverse transcriptase (an enzyme responsible for converting viral RNA into DNA) was unable to…
Q: Rainforest plants from which we extract medicines would be considered as a provisioning service.…
A: A provisioning service is any type of benefit to people that can be extracted from nature. Along…
Q: Body openings are lined by mucous membranes where a barrier, covered by mucus, secreted by peptides…
A: Epithelial Cells: These are the cells that line the body's surfaces, including the surfaces of body…
Q: 3. Diet Big Red soda contains citric acid, as shown in the ingredient list below, Carbonated…
A: Analyzing the composition of soft drinks like Diet Big Red soda includes particular chemical and…
Q: Explain the relationship between DNA sequence, amino acid sequence, and protein structure and…
A: let's break it down step by step:DNA Sequence: DNA, or deoxyribonucleic acid, is the genetic…
Q: Which of the following molecules is an inducer of the lac operon: a. Galactose d. Isothiocyanate b.…
A: The lac operon may be a well-studied model of gene control in microscopic organisms, notably E.…
Q: Tell how the impact of the Tuskegee Syphilis Study on the following: • Men involved in the study and…
A: Furthermore, the effects of the Tuskegee Syphilis Study on African Americans' access to the Covid-19…
Q: Number of individuals 10 8 6 4 64 2 0 6 On balloon vine fruits Beak- Museum-specimen average On…
A: Detailed explanation: Natural selection decreases beak length in soapberry bug populations: This…
Q: Do you think urbanization always causes fragmentation?
A: Urbanization refers to the process of population growth and migration from rural areas to urban…
Q:
A: Approach to solving the question:1. Understand the context: The question is asking about the…
Q: how does the process of exhalation influence the pH of blood, considering the role of carbon dioxide…
A: IntroductionThe process of exhalation plays a crucial role in maintaining the pH of blood by…
Q: What type of behavior? A child might stop throwing tantrums after his/her favorite toy is taken away…
A: The behavior described in the question is a form of learning behavior known as 'Operant…
Q: Please help
A: Step 1:Q.1.1 Here is your answer:Sa ≤s person Data Analysis for Ba ≤ Pty Ltd.Comp ≤ t ∈ gthe Tab ≤…
Q: Pneumonia is diagnosed by the presence of fluid (dark shadows in an X-ray image) in the alveoli.…
A: Streptococcus pneumoniae (bacterium)With over 100 identified serotypes, Streptococcus pneumoniae is…
Q: plain Constitutive and regulated enzymes with the help of a diagram.
A: In cellular metabolism, enzymes play a pivotal part in helping biochemical responses necessary for…
Q: Imagine you have been given a liquid culture of yeast with a starting concentration of 3.67 x 10'…
A: To obtain the cells after dilution:cells in the original container*dilution factor To obtain the…
Q: A patient was admitted to the ER with severe virulent E. coli bacteremia and was given a high dose…
A: 1. E. coli and its Outer Shell:• Gram-negative bacteria: E. coli falls under this category. Their…
Q: Sickle cell disease (SCD) affects millions of people throughout the world; the CDC "Centers for…
A: Detailed explanation:Sickle cell disease (SCD) is a genetic disorder characterized by abnormal…
Q: Which of the following statement regarding the whole-pathogen vaccine is/are correct (B) Live…
A: In order to tackle this question, it is crucial to comprehend the attributes of live attenuated and…
Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…
A: Transcription:Transcription is the process by which the DNA sequence is converted into mRNA. In DNA,…
Q: For question 1 what the answer And answer question 4 Please is Antro Answer it now
A: Approach to solving the question: used the image in answering the question Detailed explanation:…
Q: Very often, the invasion of hosts by pathogenic microbes leads to infections. Discuss the different…
A: Microorganisms have evolved various means to enter and colonize a host, leading to infections. These…
Q: Explain how decomposition contributes to nutrient cycling in the soils
A: Nutrient cycling refers to the exchange and transfer of biogenetic nutrients such as those essential…
Q: RBCs are recycled constantly through the bone marrow. Question 11 options: True…
A: Production and Lifespan of Red Blood Cells (RBCs)Red blood cells (RBCs), also known as erythrocytes,…
Q: STEM Workplace Practices
A: Approach to solving the question:First step: Comprehending the specificationsIn order to address the…
Q: In the digger bee, some males engage in female defense polygyny, whereas other smaller males exhibit…
A: Female Defense Polygyny in Digger Bees In the mating system of female defense polygyny Males control…
Q: otile sperm cells are found as vestiges in these two gymnosperm groups: (a) monocots, eudicots (b)…
A: A captivating feature of regenerative science within the kingdom of plants is the presence of motile…
Q: QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated…
A: Solution:
Q: Please help urgently thank you
A: Q4.1.1Mean= (5⋅5)+(15⋅18)+(25⋅33)+(35⋅11)+(45⋅3)\70 = 825+270+825+385+1\70=34.86Interpretation: The…
Q: Ss x SS What are the phenotypes of the parents ____ and _______? In words, what are the genotypes?…
A: In genetics, we have the concept of phenotype and genotype. Genotype refers to the set of genes…
Q: Fill in the blank spaces
A: The ureters carry urine from the kidneys to the bladder. The bladder holds onto the pee until the…
Q: We have a Easter egg half the egg is green x pink which would be the parents phenotypes. Offspring-…
A: 2. incomplete dominance.Here's the breakdown:Incomplete dominance: This means neither allele for the…
Q: Using the attached table that shows the total score for submissive and dominant behaviors of the…
A: 1. The interpretation of the data: The table presents information on dominating scores, which…
Q: Discuss some of the health benefits of sleep during infancy and how long children need to sleep for?
A: References:Mason GM, Lokhandwala S, Riggins T, Spencer RMC. Sleep and human cognitive development.…
Q: Enzymes are key components in biological reactions. Which of the following statements about enzyme…
A: why others are true statements: Enzymes increase the rate of a reaction but do not change the free…
Q: 1. Suppose that the three samples are from two parents and their child. Which individuals are the…
A: Approach to solving the question:Blood types are determined by the presence or absence of certain…
Q: Question 12 One of the two genes known to be mutated in cases of Hypokalemic periodic…
A: CANCA1S-202 is calcium channel, voltage dependent, L type alpha 1S subunit.It is a protein coding…
Q: How long does sperm live outside of the human body without help?
A: It's important to note that even in ideal conditions outside the body, sperm won't survive for very…
Q: Ischemic hypoxia is the result of: inability of the cells to use oxygen compromised oxygen…
A: - The inability of cells to use oxygen effectively can lead to ischemic hypoxia if they are unable…
Q: Apply the VIDA table to the evolution of sickle cell disease to justify whether it is an instance of…
A: The evolution of sickle cell disease using the VIDA table to provide a detailed analysis:1. Is there…
Q: The trumpeter finch is a bird in the least concern category. What does this mean?…
A: The reason the "least concern" category indicates the trumpeter finch is abundant is due to the way…
Q: ering where Fucus lives, what do you think is the function of its gelatinous sheath?
A: Fucus, commonly known as rockweed or bladderwrack, could be a sort of brown algae found in…
Q: hello what 5 +5
A: The given question is what is 5+5So, we will use the BODMAS rule for adding the two numbers…
Step by step
Solved in 2 steps
- First letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter сIf the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTFirst letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letter
- Why do you think this substituion is named " NonSense". In your response explain what it means to have a stop codon. Use evidence from the diagram. Ready? Enter your answer here.Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- The name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codonA point mutation within a codon that does not change the resulting amino acid sequence is known as a/an: 1nonsynonymous mutation 2synonymous mutation 3insertion-deletion mutation 4noncoding mutationQuestion 10 Review mutations. Match the term and its description. Each term can only be used once. changes in just one nucleotide pair of a gene | Choose | These mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code [ Choose J These mutations still code for an amino acid, but not the correct | Choose | amino acid These mutations change an amino acid codon into a stop codon: most lead to a nonfunctional protein | Choose In this mutation, insertion or deletion of nucleotides may alter the reading frame | Choose | additions of nucleotide pairs in a gene | Choose > > > > >
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G A