Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…
A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…
Q: Name the two types of mutagens, give an example for each, and briefly describe how they cause…
A: Mutagen is a physical or chemical agent that permanently changes genetic material,usually DNA , in…
Q: You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will…
A: The method of DNA cloning is used to produce the multiple identical copies of the specific template…
Q: Human Genome Project In 2003, the Human Genome Project was successfully completed, determining the…
A: A gene patent is a government-granted exclusive right to a particular sequence of DNA (a gene) to…
Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Why do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas…
A: A cDNA (complementary deoxyribonucleic acid) library is a combination of cloned cDNA fragments…
Q: Design as a set of primers, every 20 nucleotides in length. Using this sequence as a guide, design a…
A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…
Q: You have isolated a transposable element from the human genome and have determined its DNA…
A: Transposable element also known as jumping gene, is a DNA sequence which can change its position in…
Q: Why the sequence alignment is extremely important in designing a construct for developing a…
A: Sequence alignment It is defined as the way of arranging the sequences of DNA, RNA or protein to…
Q: To clone a bacterial lipase gene into the cloning vector pET28a, you know the full sequence of the…
A: For the ease of manipulation, vectors must be relatively small molecules. They must be capable of…
Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…
A: The mutation is a permanent alteration in the nucleotide sequence of DNA molecules. The mutation…
Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…
A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: Genetics is the study of how traits are passed from one generation to another. This includes but is…
Q: Human Genome Project In 2003, the Human Genome Project was successfully completed, determining the…
A: Patency can be defined as the term used for the proper authorisation or consent of a particular…
Q: You are working with a newly discovered mutagen, and you wish to determine the base change that it…
A: Mutagens often cause alterations in the DNA by changing bases. Substitutions are common examples…
Q: If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence…
A: Gene probes are of three types: gene-specific probes, polymorphic probes and oligonucleotide probes.…
Q: What is mutagen? Give an example?
A: Genetic is a branch of science that deals with genes, DNA, alleles, genetic variation, heredity, and…
Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…
A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…
Q: You just graduated from college and started working at a biotech startup called Scrofabulous. Your…
A: Gene is cloned with the help of polymerase chain reaction(PCR). PCR is a rapid in vitro method to…
Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…
A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…
Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…
A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…
Q: Predict the resulting DNA strand in the presence of a mutagen that causes the ADDITION of one…
A: During protein synthesis pathway, the N-terminus is the first component of the protein to leave the…
Q: As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how…
A: Introduction Genetic code The sequence of bases that encodes a functional protein molecule is…
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: The genome of Drosophila melanogaster, a fruit fly, was sequenced in 2000. However, this “completed”…
A: Answer: Introduction: The Drosophila melanogaster heterochromatin sequence by the Drosophila…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: They are few methods which are used to to separate and identify the gene of interest. To isolate a…
Q: Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is…
A: Step 1 Sequencing is the establishment of the primary structure of an unbranched polymer. Sequencing…
Q: sequences below to determine what type of mutation has occurred by comparing the normal sequence to…
A: Original sequences produce normal or regular phenotypes. Mutated sequences produce new phenotypes.…
Q: Discuss why it is useful to search a database to identify sequencesthat are homologous to a newly…
A: The most basic operations in bioinformatics involves searching for similarities, or homologies,…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…
Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the Eco…
A: The human genome project was started in the year 1990, the main objective of this genome project is;…
Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…
A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…
Q: Hi, I would like to know which program is used for the graphical presentation of the results of a…
A: A genome wide linkage association study (GWAS) is an approach used in genetic research to associate…
Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…
A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…
Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI…
A: No, because most humans genes are much longer than 4kb.
Q: The goal of many computer programs is to identify sequenceelements within a long segment of DNA.…
A: The collection of instructions executed to perform a specific task by a computer is called the…
Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: A number of scientists who study cancer treatment have become interested in telomerase. Why? How…
A: The ends of the linear chromosomes are called telomeres. Replication of DNA by DNA polymerase…
Q: Karenca was studying her genetics notes the night before the test. She was getting a little turned…
A: Mutation is sudden change in the sequence of DNA during the time of cell division, environment…
Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…
A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…
Q: Nucleosomes can be assembled onto defined DNA segments. When a particular 225-bp segment of human…
A: A nucleosome is a piece of DNA that is encased in a protein core. Chromatin is a protein complex…
Q: I recently isolated the human enzyme called fucosidase and prepared anantibody to it. Now I want to…
A: A probe is one of the essential components necessary to identify a gene during cloning. A probe is…
Q: Let’s say, you want to deliver a gene into a cell and in your lab, there are lot of options…
A: Gene transfer: Method or process by which a gene is transferred from one DNA molecule to another.…
Q: How would you modify the Ames test to evaluate physical mutagens?Would it be necessary to add the…
A: Physical mutagens involve the radiation like ultraviolet rays, X rays, gamma rays and alpha and beta…
Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. a. How…
A: Introduction The Human Genome Is A Full Set Of Nucleic Acid Sequences For Humans, Encoded As DNA In…
Q: What is the significance of digesting the 16S rRNA product in 16s gene sequencing?
A: The 16S rRNA is a structural component of the 30S ribosomal subunit of bacteria and archea.
Ali sequenced a plant protein. He is not a bioinformatician and is actually scared of computers. Yet, he would like to know what the structure might look like to do some rounds of rational mutagenesis. I told him I would collect a group of bioinformaticians to solve this problem. Please don't disappoint him. He came up with this sequence:
SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN
Find the template?
Use swiss model to build the structure?
Step by step
Solved in 4 steps with 4 images
- Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries I use a comparative genomic approach and use sequence homology with the genome of a closely related species I use a comparative genomic approach and use sequence homology with the genome of a distantly related species Both A and B Both B and C Why did you bother to identify the introns? So that I could include them in the sequence to understand intron function. So that I could exclude them from the sequence because prokaryotes don't have spliceosomal machinery. So that I could see how introns affect protein folding.What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…
- You are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop codon) of the following gene. Please write down the sequences of primers. (Indicate the 5' and 3' of the primers). 4. 5'atgaagaccaatagagagcaggaaatttacgttgaaagaagcttcaaaccaaacaattcaacaattcagaatttgatggacattgaaag gttcattttgcctcacacttctacatcaggtgtcgcaaggctcaaaatgagggtcatatcatgggtegggcttcagttctacaactactga-3’Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'Great! Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? O Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries O l use a comparative genomic approach and use sequence homology with the genome of a closely related species O luse a comparative genomic approach and use sequence homology with the genome of a distantly related species O Both A and B O Both B and C
- Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisName any two cloning vectors. Describe the features required to facilitate cloning into a vector.Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
- For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGAfter Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC