Similarly, hypoxanthine (HX) can be used to label purine residues. As in Problem 4, write reactions showing the conversion of hypoxanthine to dATP and dGTP.
Q: . Most bacterial mutants that require isoleucine for growth also require valine. Why? Which enzyme…
A: A mutation is a permanent alteration in the sequence of nitrogenous bases of a DNA molecule.
Q: Based on the structure of CBB G-250, explain why it can bind to proteins having basic and…
A: CBB G-250 (Coomassie Brilliant Blue G-250) is a dye used to visualize proteins. There are two types…
Q: In pyrimidine nucleosides the anti conformation predominates because of steric interactions with…
A: Pyrimidine nucleosides have anti-conformation as the oxygen molecule present on the second carbon is…
Q: What are the differences between synthesis of phosphatidylethanolamine in prokaryotes and…
A: Glycerol is a polyol compound that is made up of more than one hydroxyl group. Glycerol is a…
Q: Draw the arrow-pushing mechanism for this knowing that histidine amino acid residue acts as a…
A:
Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…
A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…
Q: Discuss the Pharmacokinetics of morphine sulfate using the correct sequence you have chosen in…
A: Morphine is a drug that targets a specific type of receptor that affects multiple processes. It does…
Q: Peptide YY (PYY) is a 36-amino acid peptide that is so named because it contains twobiochemically…
A: Peptide YY (PYY) is 36-amino-acid peptide and contains two biochemically relevant tyrosine residues
Q: Sodium nitrite, a common food preservative (page 906), is capable of causing mutations in an acidic…
A: Sodium nitrite, a common food preservative , is capable of causing mutations in an acidic…
Q: Similarly, hypoxanthine (HX) can be used to label purine residues. As in Problem 4, write reactions…
A: It is given that hypoxanthine can be used to label the purine residues. Hypoxanthine always pair…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: a-D-Galactopyranose rotates the plane of polarized light, but the product of its reduction with…
A: Galactopyranose is a rare genetic disorder that affects how your body metabolised galactose.…
Q: describe a detailed experimental procedure for the chemical synthesis of proteins with the…
A: Proteins are vital biomolecules that plays key role in biochemical pathways. It is synthesized in…
Q: Explain why cleavage of the bond between arginine 15 and isoleucine 16 of chymotrypsinogen activates…
A: Enzymes are known as biological catalysts in which help to catalyze the different biochemical…
Q: whyThe method of oxidation of galactose by concentrated nitric acid is used to detect this sugar?
A: Qualitative tests help to detect the presence of different carbohydrates in a given sample.…
Q: L-Amino-acid oxidase will catalyze reactions of L-amino acids but not of D-amino acids. Which of the…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: Consider a mutation that results in a substitution of Cysteine (CYS) ) for Tyrosine (TYR) at…
A: Cysteine is a polar amino acid. Cysteine is a triprotic acid with three ionizable functional…
Q: Please provide a chromatography technique to isolate the protein A from the mixture containing…
A: Chromatography is the technique used for the separation of molecules or analytes from the mixture by…
Q: Construct a Lineweaver-Burk plot to answer the following questions: (a) What are the apparent KM and…
A: The Lineweavwe-Burk plot is the plot between 1/[V] vs 1/[S]. Km = -1/ x-intercept Vmax= 1/y…
Q: What is known as polyadenylation signal sequence ?
A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…
Q: Draw the structure of the PTH derivative product you would obtain by Edman degradation of the…
A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…
Q: Consider a hexapeptide of the sequence thr asn glu trp lys gln. After complete hydrolysis, which…
A: Asked : Amino acid which elutes first
Q: Why different amino acids have different Rf values? If you separate a mixture of amino acids consist…
A: Paper chromatography is the separation technique where the mixture of the amino acids was separated…
Q: What's the simple rule to predict ligand binding sites for Rossmann Fold
A: Proteins are polypeptides consisting of unbranched polymers constructed from 22 standard α-amino…
Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…
A: Oligosaccharides are molecules that consist of many smaller monosaccharide units. Oligosaccharides…
Q: There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin…
A: The cells in the middle lobe of the pituitary gland contain melanocyte-stimulating hormone and they…
Q: What is the purpose of dideoxyribonucleoside triphosphates, or ddNTPs?
A: DdNTPs are called as dideoxynucleotides triphosphates. It includes 4 types of nucleotides i.e…
Q: Why do both thymine and uracil specify the incorporation of adenine?
A:
Q: Two melanocyte-stimulating hormones have the following amino acid sequences. Take a highlighter or…
A: Conserved sequences are the amino acid sequence that remain identical between two or more species…
Q: Why is there no net gain of methionine if homocysteine isconverted to methionine with…
A: Methionine is an amino acid which is found in meat, fish and dairy products and it plays an…
Q: What features distinguish enzymes that undergo allosteric control from those that obey the…
A: Enzymes are the biocatalyst molecules that increase the rate of reaction by decreasing the…
Q: What is the Rf value of each amino acid observed?
A: Rf ( retardation factor):- It is defined as the ratio of distance traveled by the centre of a spot (…
Q: Individuals with phenylketonuria (PKU) are sensitive to phenylalanine in their diet. Why is a…
A: Phenylketonuria (PKU) is considered a rare genetic disorder, which is not able to utilize the amount…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: A patient is suffering from hemoglobinopathies and the principal biochemical defect that leads to…
A: Haemoglobinopathies is a blood disorder.
Q: Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide…
A: The amino acids that form peptide chains can be either polar/non-polar, charged/uncharged,…
Q: The text states that in E. coli ribonucleotide reductase Tyrosine-122 was identified as the source…
A: Ribonucleotide reductase (RNR) is a key enzyme that mediates the synthesis of deoxyribonucleotides,…
Q: In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides…
A: Introduction and Explanation: Pyrimidines and purines are the nitrogenous bases that are present in…
Q: you have the following peptide Arg-Ile-Pro-Leu-Asp-Lys-Glu The net charge on this peptide at pH 7.0…
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…
Q: Bisphosphoglycerate lies in a central cavity within the hemoglobin tetramer, stabilizing the T…
A: Hemoglobin (Hb) is the protein complex, which is a tetramer in a structure that binds to the oxygen…
Q: In studies using repeating copolymers, AC . . . incorporates threonine and histidine, and CAACAA . .…
A: A protein's amino acid sequence is determined by the sequence of nucleotides in DNA and RNA. It is…
Q: Most bacterial mutants that require isoleucine for growth also require valine.Why? Which enzyme or…
A: Mostly the bacteria that require the isoleucine amino acid for growth also requires valine. This is…
Q: What fragments can be generated in the decapeptide Gly-Lys-Ala-Met-Gly-Gly-Phe-Tyr-Trp-Ala if is…
A: Note: it is assumed that the left side of the sequence is the N terminal and the right side of the…
Q: The trypsin enzyme is able to hydrolyze a peptide substate at the carboxyl side of an Arg or Lys…
A: Enzymes are protein molecules that increase the rate of enzyme reactions by decreasing the…
Q: How does fructose-2,6- bisphosphate play a role as an allosteric effector?
A: A molecule that binds to an enzyme and causes allosteric effects is known as an "allosteric…
Q: By means of a structural formula, show how S-adenosylmethionine is a carrier of methyl groups.
A: S-adenosylmethionine is a cofactor involved in methyl transfer in biochemical reactions. Where it…
Q: What complication could arise from the biological synthesis of ceramide?
A: * ceramides composed of sphingosine and fatty acid. * They are mainly present in cell membranes with…
Step by step
Solved in 2 steps
- The substrate which was used to investigate the enzymatic activity of wheat bran phosphatase was p-nitrophenyl phosphate. It is converted to p-nitrophenol and inorganic phosphate by this enzyme. P-nitrophenol has a pKa of 7.1 and is colorless, while its conjugate base, p-nitrophenolate has a yellow color. The enzyme assay was performed at pH 5.1 after the 0.5 N KOH is added at the end of each enzyme assay, the pH of the assay mixture is raised to 9.1. Why was the base added?Diisopropylphosphofluoridate (DIPF) inactivates chymotrypsin by covalently modifying serine 195. Which statement is true of DIPF's inhibitory mechanism? DIPF randomly modifies all serine residues on the protein, and if enough is added, the serine in the active site will eventually be modified. DIPF approaches serine 195 more closely than other substrates. DIPF looks like the substrate for chymotrypsin and binds in the active site as a competitive inhibitor. Serine 195 is in an environment that gives it a higher than normal reactivity with respect to DIPF.Please answer the pKa Values and Identity of Lysine
- The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of β-Dglucose to D-glucono-δ-lactone. This enzyme is highly specific for the β anomer of glucose and does not affect the α anomer. In spite of this specificity, the reaction catalyzed byglucose oxidase is commonly used in a clinical assay for total blood glucose—that is, for solutions consisting of a mixture of β- and α-D-glucose. What are the circumstances required to make this possible? Aside from allowing the detection of smaller quantities of glucose, what advantage does glucose oxidase offer over Fehling’s reagent for measuring blood glucose?Escherichia coli Fpg protein is responsible for removing damaged DNA base pairs such as C8-oxoguanine (8-oxoG). The catalytic mechanism is believed to involve the formation of a transient Schiff base intermediate formed between DNA base the N-terminal proline residue. Draw the structure of PTH-derivative that is formed after Fpg is subjected to one cycle of Edman degradation.For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
- The objective is to study a novel protease P isolated from the digestive tract of an Amazonian insect. This protease can exist into two forms Pi and Pa which have identical amino acid sequences (both of 80 kDa). However, only Pa shows proteolytic activity. To better understand the activation mode of Pi (inactive form) in Pa (active form), the following experiment was done using DIPF. DIPF (diisopropylphosphofluoridate) is a well-known irreversible inhibitor of serine proteases. It reacts with the catalytic serine residue of the active site of proteases as shown below: Enzyme -CH₂OH + CH(CH3)2 O F-P=0 O CH(CH3)2 Diisopropylphospho- fluoridate (DIPF) Enzyme -CH,—O CH(CH3)2 O <=0 O CH(CH3)2 DIP-Enzyme Both proteases Pa and P₁ were incubated with 32P-DIPF for 30 min at 37°C, and then dialysed to remove excess of unreacted radiolabelled reagent. The two proteases were then analyzed in Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis (SDS-PAGE), with and without 2-mercaptoethanol.…What would be the effect on the activity of phosphofructokinase of the mutation of Asp103 to the unusual amino acid shown below? Explain in terms of actual structures of the side chains of Asp and this unusual amino acid.Why is COVID-19 a man made? (Brief explanation only atleast 3-5 sentences)
- Mutants of Neurospora crassa that lack carbamoyl phosphate synthetase I (CPS I) require arginine in the medium in order to grow, whereas mutants that lack carbamoyl-phosphate synthetase II (CPS II) require a pyrimidine, such as uracil. A priori, one would expect the active CPS II in the arginine mutants to provide sufficient carbamoyl phosphate for arginine synthesis, and the active CPS I in the pyrimidine mutants to "feed" the pyrimidine pathway. Explain these observations.Which of the following correctly describes the regulation and activity of HIF-1? Group of answer choices VHL is required for preventing degradation of HIF-1alpha and promoting translocation to the nucleus In normoxia, HIF-1alpha is ubquitinated and degraded in the proteasome Hypoxic conditions result in increase hydroxylation of prolines in HIF-1alpha The primary function of HIF-1 is to phosphorylate and activate glycolytic enzymesWhat is application of D_alanine?