How many open reading frames are present in the following mRNA sequence? You may find the codon table helpful.   5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: UUU UUC UUA UCU) UCC UÇA UCG UAU Tyr UACS Phe UGU U Ser UGC Cys UUG Leu UAA Stop UGA Stop A UAG Stop…

A:

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation:  A missense mutation is a point mutation that results in a codon that codes for a…

Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…

A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…

Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…

A: The translation is a process in which the genetic information in the mRNA strand is converted into…

Q: m

A: DNA → RNA RNA → protein

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…

A: With the help of translation process protein forms. The nucleotide sequence are translated into…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…

A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…

A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…

A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…

A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…

A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…

Q: The sequence below shows the non-coding strand from the whole of the transcribed region of a very…

A: DNA undergoes transcription process to synthesize mRNA, which undergoes translation to synthesize…

Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…

A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the…

A: Shine-delgrano sequence in mRNA is essential for the binding of prokaryotic ribosomes to carry out…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction   Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: ook at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the…

A: Note- According to the guidelines, only the first three questions can be answered out of MCQs.…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? *   A.…

A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes  which consists of exons with all…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A.  The…

A: The single-stranded RNA is called messenger RNA.  The ribosomes read an mRNA when making proteins.…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…