Give a possible nucleotide sequence for the template strand of the gene that codes for this tripeptide. OH -|||||||| OH HO Note: Reference the Genetic code table for additional information.
Q: In Fehling’s test, aldose are oxidized to aldonic acid. Kindly give the reaction and mechanism of…
A: Fehling's test is a chemical test used to distinguish the presence of reduced sugars in a given…
Q: You are studying Protein A. In the picture below, which location is Protein A MOST likely to move…
A: Membrane proteins are defined as proteins associated or attached to the membrane of a cell or an…
Q: most organisms use D-glucose as a primary metabolic fuel. predict what would happen if only…
A: The question is asking us to predict the metabolic consequences if organisms, which normally use…
Q: Which of the following is not a CYP450 catalyzed oxidation/reduction reaction? O A. deamination OB.…
A: The Cytochrome P450 (CYP450) enzymes are a group of enzymes that play a crucial role in the…
Q: Why must NH3 be transported as part of an amino acids vs. being released into circulation? What…
A: Ammonia is produced in all tissues of the body during the metabolism of amino acids and other…
Q: The urea cycle can be summarized through the following reaction: O || H2N-C-OPO3™ + COO- T…
A: When amino acids are degraded in the tissue, they release ammonia. Ammonia is toxic to the cell so…
Q: How many oxygen atoms are reduced from each nadh and fadh
A: By the end of citric acid cycle most of the energy has been converted into high energy electrons in…
Q: The activity of chymotrypsin changes as the pH changes in the range of pH 5-9, as shown on the a.…
A: Chymotrypsin is an enzyme that aids in breaking down proteins within the body. It is produced by the…
Q: 1a. If you wanted you could take a glucose molecule and convert it to pyruvate via glycolysis and…
A: Hello! Due to time constraints, we are able to provide the answer for the first sub part only. If…
Q: The bonds that hold a cytoskeletal polymer together are best described as... -Covalent,…
A: The cytoskeleton is a network of different protein fibers that provides many functions: it maintains…
Q: A contributing factor to the development of arthritis is the inappropriate proteolytic destruction…
A: Enzymes are proteins that catalyse biochemical reactions. An enzyme's activity is a reference to the…
Q: Which of the following describe roles of an enzyme in an enzyme-catalyzed reaction? bind the…
A: The general property of enzymes in an enzyme catalyzed reaction is that they alter the kinetics of…
Q: Identify the species that are liganded to the porphyrin ring Fe(II) ion in deoxyhemoglobin (i.e., Hb…
A: The protein haemoglobin, which is present in red blood cells, is essential for the movement of…
Q: 9. ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. Fill in the blanks…
A: Amino acids have a hydrogen, a carboxyl group, an amino group and a chemically diverse side group…
Q: A protein has binding affinity for its ligand of KA = 2 x 105 1/M at pH 5.0 and room temperature. a.…
A: Kd is the dissociation constant for a protein-ligand complex that measures the affinity with which a…
Q: results from hydrogen bonding between the backbone constituents of the overall shape of a…
A: There are four classes of biological macromolecules; nucleic acid, proteins, lipids and…
Q: Which of the following sites represents the anomeric carbon? О ОН B O с A E D C A D CH3OH ОН ОН E OH
A: Carbohydrates are poly hydroxy aldehydes or ketones.Carbohydrates can be classified as…
Q: Dimethoate is a commonly used agrochemical. However, chronic exposure to it can cause an individual…
A: Hyper-ß-alaninemia is a condition characterized by excessive alanine in the muscles. In the context…
Q: Glucagon is a hormone that is released when the level of glucose in the blood is low. Glucagon uses…
A: Glucagon is secreted by the α cells of pancreas.Glucagon is a hormone that helps to regulate blood…
Q: 1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the…
A: Enzyme kinetics:The study of the reaction rates of enzyme catalyzed reactions. Initial reaction rate…
Q: 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted D…
A: 1) A somatic human cell has 23 pairs of chromosomes, that is 46 pieces of DNA. The combined length…
Q: 1. Start with the Michaelis-Menten equation and convert it to a double-reciprocal equation. Show how…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Choose Two. The Ramachandran plot indicates: B Ca E ||||||| C1 H H A Combined preference for a about…
A: Amino acids are the building blocks of protein. There are 20 standard naturally occuring amino acids…
Q: (i) During the Pyruvate Decarboxylase (PDC) catalysed reaction, a covalent coenzyme intermediate is…
A: Pyruvate Decarboxylase (PDC) catalyzes the decarboxylation of pyruvate to produce acetaldehyde and…
Q: The F₁F. - ATP synthase is a molecular machine that converts the proton motive force into enzymatic…
A: The molecular device known as F1F0-ATP synthase transforms the proton motive force into enzymatic…
Q: Oxygen is mainly carried through blood in what form?
A: Oxygen is essential for ATP generation through oxidative phosphorylation, and therefore must be…
Q: What is the difference between an orange Bial's reagent and a green Bial's reagent if both of them…
A: Bial's reagent is a chemical solution utilized in carbohydrate analysis, especially for the…
Q: Enzyme X follows Michaelis-Menten kinetics. You add an inhibitor to your enzyme and you notice that…
A: The Michaelis-Menten equation is used to describe the kinetics of enzyme catalyzed reactions. It…
Q: The extraction of energy from food molecules by aerobic organisms can be described as taking place…
A: The process that is referred in the question is nothing but cellular respiration.Cellular…
Q: Which of the following statements are true about fatty acids? Fatty acids are referred to as…
A: The fundamental building blocks of fats and lipids in living things are organic molecules called…
Q: Briefly explain the advances in glucose monitoring techniques over the past sixty years.
A: The glucose monitoring techniques refers to the procedures and equipment used to monitor blood…
Q: The KM for the reaction of chymotrypsin with Substrate A is 8.8 x 10-4 M, while the KM for the…
A: The Michaelis Menten constant (KM) can be used as a measure of the enzyme's affinity for its…
Q: Lipids in a bilayer can diffuse laterally at a relatively fast rate, but "flip-flop" from one…
A: Flippases, floppases, and scramblases are phospholipid translocators present in the membrane…
Q: Liquid hexane (CH,(CH₂) CH) will react with gaseous oxygen (0.) to produce gaseous carbon dioxide…
A: Mass of hexane = 18.g Mass of oxygen gas = 32.6 gMinimum mass of hexane left over by the chemical…
Q: I would like to ask the following since I kinda don't clearly understand the concept behind them:…
A: Starch, glycogen and dextrin are homopolymer of glucose meaning that they are polysaccharides that…
Q: Oxidation Answer Bank ease in the number of carbon-oxygen bonds bon-oxygen bonds loss of hydrogen…
A: Oxidation and reduction reactions are the reactions in which there is either gain or loss of…
Q: A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the…
A: Answer :- The scenario with peptidyl-tRNA in the P site—a part of the ribosome involved in protein…
Q: 16. Identify the functional groups on the amino acid glutamine and mark the Ca. HO. I. 17. The amino…
A: The proteins are constituted of twenty naturally occurring amino acids.The α-Amino acids (AAs) are…
Q: Draw the product of the reaction of acetyl CoA with CO2 catalyzed by acetyl CoA carboxylase in the…
A: Fatty acid synthesis is an essential process in the body as many structural and functional…
Q: Draw the skeletal ("line") structure of an aldehyde with 3 carbons in the main chain and 1 methyl…
A:
Q: The urea cycle can be summarized through the following reaction: O COO- || H₂N-C-OPO3 +…
A:
Q: Exposure to the compound below is most effectively treated with? CI CI N CI O O CH3 CH3
A: Organophosphate are a group of synthetic pesticides that are used on crops and animals.…
Q: Identify the parts of the G protein shown in the image. GB C Ga O GDP Answer Bank B subunit y…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called the…
Q: Lipid storage droplets are the only human organelle known that is bound by phospholipid monolayer…
A: A lipid monolayer is a single layer of lipid molecules that forms at the interface between two…
Q: 26. Draw a figure of a lipoprotein-containing structure that carries lipids.
A: Ingested fat is emulsified in the small intestine by bile salts released from gall bladder to form…
Q: Benedict’s test.
A: Benedict's test:This is the where it is used to detect the presence of reducing sugars, such as…
Q: For the following reaction mechanism, which of the following statements would be false? R" R .H H H…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: The KM values for the reaction of chymotrypsin with two different substrates are given in the table…
A: Km, also called the Michaelis Menten's constant is a measure of the enzyme's affinity for the…
Q: An enzyme mechanism generates a positive charge in the transition state. Stabilization of the…
A: The intermediate state which is formed during a reaction is called transition state.This transition…
Q: List the symbol for each type of glycosidic bond in the molecule above. For example, if there are…
A: A bond formed between two saccharide units by condensation of their -OH groups is called a…
Step by step
Solved in 3 steps
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'