Q: Organic monomers joined to form organic polymers is the stage number evolutionary biologists. of the...
A: Origin of life: Stanley L. Muller and Harold C. Urey first conducted the experiment to show origin o...
Q: Plants store extra glucose inside the cell as fiber? A. True B. False
A: INTRODUCTION The plant stores excess glucose in the form of starch.
Q: Problem: What is the primary cause of the endangerment of Varanus mabitang (Panay Monitor Lizard)? ...
A: The Panay monitor (Varanus mabitang) is an endangered Monitor lizard. The monitor lizard are harmful...
Q: DISEASE CAUSATIVE ORGANISM VECTOR
A: Causative organism or agent in infection are pathogens. vector is a quantity or phenomenon that has...
Q: DNA technology in medicine can reduce human suffering by:
A: DNA technology is an advanced technology that is applied in medicine whether in detection of the dis...
Q: To which phylum do you think the Penicilium and Aspergillus fungi belong to?. Please explain what ar...
A: There are aproximately 50,000 species of fungi exists and out of which only 100-150 got identified. ...
Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...
A: In a cross, the arrangement of linked alleles on the chromosomes is critical for determining the out...
Q: B Which of the bacterial colonies shown (A or B) was nonlethal when injected in mice? A В
A: Introduction A bacterial colony is a collection of bacteria that all came from the same mother cell....
Q: Which of the following best describes an emergent property? Group of answer choices a property that...
A: The organ system is a very complex creature made up of several systems. Each system in the body has ...
Q: In a fed-batch culture operating with intermittent addition of lactose solution, values ofthe follow...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A ...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: What genes from the mitochondrion are also used for phylogenetic analysis
A: Phylogeny involves studying evolutionary relationships between organisms. Molecular phylogeny involv...
Q: a. When was the glucose level at its lowest value? Why? b. What specifically are the independent va...
A: Diabetes is an infection that happens when your blood glucose, called sugar, is excessively high. Bl...
Q: Energy is stored long-term in the bonds of used short-term to perform work from a(n) molecule. and a...
A: Adenosine triphosphate (ATP) is the energy currency of all living cells. Cells need ATP molecules to...
Q: Identify the differences between a prokaryotic and a eukaryotic cell. Discuss the structures found i...
A: A cell is the basic unit of life. A cell is made up of a liquid portion called the cytoplasm, which ...
Q: If you crossed a heterozygous fruit fly with straight wings and red eyes to one with curly wings/whi...
A: A phenotypic ratio helps to determine the likelihood of a trait and is most easily determined by uti...
Q: Identify the structures labeled a and b on the figure below. noitesinsgnO In
A: Chip budding is a grafting technique. A chip of wood containing a bud is cut out of scion with desir...
Q: The prairie is approximately 100 acres of relatively flat terrain. Considering the “basic” sampling ...
A: A... Forest Administration is presently carrying out an eating the executives plan at Sheyenne Publi...
Q: t is 9 am in the morning and David has not eaten since dinner last night at 8 pm. He has fasted for ...
A: The dependent variable is the effect and it depends on other variables and changes as per the change...
Q: Week 4 BIO 202 worksheet Blood vessels 1. What is the name of the outermost layer of a blood vessel?...
A: Note :- Since you have asked multiple questions im only answering the ist 5 as per bartleby guidelin...
Q: 3. In people suffering from severe malnutrition, OP is often low because a lack of dietary amino aci...
A: Malnutrition is a condition of body in which the body lack nutrients that are important for maintain...
Q: Relative to asconoid organization in sponges the syconoid form exhibits smaller body size increased...
A: Sponges comes under phylum Porifera and they have three different types of body plan. 1)Asconoid spo...
Q: What are the importance of nitrogen and potassium in plants?
A: Plants need various nutrients in form of biomolecules for its activities , these elements are divide...
Q: Explain in detail Structure reproduction and life cycle of agaricus.
A: Introduction :- Agaricus, popularly known as mushroom, is an edible fungus. It's a saprophytic fungu...
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylat...
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in euka...
Q: How is palmitoylation inhibited?
A: Answer
Q: The force causing air to flow into the lungs during ventilation is: Decreased lung pressure Increase...
A: Air flows inside and outside the lungs die to the pressure difference in atmosphere and inside lungs...
Q: hén a homozygous plant that produces purple fruit (RR) is crossed with a homozygous plant nat produc...
A: Provided that all of the F1 progenies generate violet eggplant, while neither of the parents do. As ...
Q: what are the factors affecting visual perception of humans?
A: Visual perception is the ability to interpret the surrounding environment through photopic vision (d...
Q: Gas exchange occurs in which part of the respiratory system? Select ALL correct answers: O Alveoli T...
A: The part/parts of the respiratory where gas exchange occurs is described in details in step 2.
Q: The energy needed to start a chemical reaction in the body is called and is (raised or lowered?) by ...
A: Introduction:- The activation energy is the energy required to start a reaction. Enzymes are protein...
Q: Weight Metabolism 3.6 Animal Animal Weiglht Metabolism Mouse 0.021 23.6 Dog Chimpanzee Sheep 872 Rat...
A: Allometry -- Allometry is an empirical expression of the distribution of biomass between aboveground...
Q: Science Pd Plant Parts Plants are A Vascular DAutotrophs ©Heterotrophs 2. What can vascular plants d...
A: Introduction :- A heterotroph is an organism that obtains energy and nutrients from other plants or ...
Q: Review of the Anatomy and Physiology of the brain Fil out the table below Section of the brain (fore...
A: Human brain The brain is the central information processing organ of our body and acts as as the 'c...
Q: Which of the following statements about CRISPR are accurate? Select all that apply. O CRISPR require...
A: The most accurate statements regarding CRISPR are - a, c and e.
Q: Data for two populations are shown below in Figs (a) and (b), respectively. The slopes of the best f...
A: ANSWER;- Correct answer is a,d,e
Q: 4. An X-linked dominant trait with an unaffected mother and an affected father.
A: X linked dominant This type of Inheritance refers to the mutations in the genes that are present on...
Q: Fruit flies (Drosophila) were mated. Cross #1 - 2 male red eyes (se+), wild wings(ap+) X 4 female r...
A: The Dihybrid cross is a crossing between two organisms, being heterozygous to two different traits. ...
Q: What salt did Meselson and Stahl use for their ultracentrifuge gradients? O NaCI O NH4CI O CSCI O Ca...
A: Given: DNA replicates semiconservatively. Matthew messelson and Franklin stahl performed an experime...
Q: Where is the cytoplasm located in the anabaena and is the cytoplasm interconnected?
A: Given: Anabena is a genus of nitrogen fixing cyanobacteria blue green algae. Colonies grow in filame...
Q: What process begins endosperm formation? How is the endosperm important to plants?
A: Formation of endosperm and its importance to plants: The endosperm is formed during the double ferti...
Q: Question 11. What is the definition of “essential nutrients”? A. nutrients that are essential for m...
A: Essential nutrients are one that cannot be synthesized by the body and therefore must be supplied fr...
Q: Hello good day, I hope today has been kind to you. So I am having a problem answering this question ...
A: Histology is made up of a Greek word histos that means tissues or columns, logia means study. It can...
Q: Methods of Bioremediation does not include Select one: a. Bioaugmentation b. Phytoremediation c. Bio...
A: Bioremediation: Bioremediation is a field of biotechnology that involves the removal of contaminants...
Q: What's the difference between natural and artificial flavors?
A: Introduction A food flavoring or flavoring, often known as flavoring or flavouring, or fragrance, i...
Q: A food molecule that contains 17 covalent bonds contains more energy that a food molecule that conta...
A: Answer A food that contains more covalent bond needs more energy because covalent bonds are the st...
Q: Let's work on Z and D values. In the graph below, what are the z-values for each of the curves shown...
A: Linear (XY) graph has points that show the relationship between two sets of data. A XY Line graph us...
Q: Why is it an advantage for eukaryotic cells to have different compartments (aka organelles) in the c...
A: Introduction Organelles are small structures that work together in the cytoplasm to carry out life f...
Q: - What is a pure culture? - Describe the procedure for making a streak plate from a clinical specime...
A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...
Q: How many different kinds of F1 gametes, F2 genotypes, and F2 phenotypes would be expected from the f...
A: Genotype The genetic constituent of an organism is known as genotype.
Oogenesis
The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase.
Cell Division
Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons:
Step by step
Solved in 2 steps
- The pairing of homologous chromosomes occurs during which ofthe following?a. mitosisb. meiosis Ic. meiosis IId. All of these are correct.The final outcome of meiosis in the ovaries results in: a. Three functional gametes b. the formation of two identical daughter cells c. two functional gametes d. four functional gametes e. one functional gameteWhat is the significant events of the stages in Meiosis? (explain in 2-3 sentences)a. Prophase Ib. Metaphase Ic. Anaphase Id. Telophase Ie. Prophase IIf. Metaphase IIg. Anaphase IIh. Telophase II
- Which of the following cells canundergo meiosis?a. the diploid body cells of an animalb. haploid gametesc. germ cellsThe product of meiosis describes the following, except: A. Produces somatic cells B.Genetically distinct from each other. C.Four haploid cells D. Produces gametesChoose the best matching phrase in the right columnfor each of the terms in the left column.a. meiosis 1. X and Yb. gametes 2. chromosomes that do not differbetween the sexesc. karyotype 3. one of the two identical halvesof a replicated chromosomed. mitosis 4. microtubule organizing centersat the spindle polese. interphase 5. cells in the testes that undergomeiosisf. syncytium 6. division of the cytoplasmg. synapsis 7. haploid germ cells that uniteat fertilizationh. sex chromosomes 8. an animal cell containing morethan one nucleusi. cytokinesis 9. pairing of homologouschromosomesj. anaphase 10. one diploid cell gives rise to twodiploid cellsk. chromatid 11. the array of chromosomes in agiven celll. autosomes 12. the part of the cell cycle duringwhich the chromosomes are notvisiblem. centromere 13. one diploid cell gives rise to fourhaploid cellsn. centrosomes 14. cell produced by meiosis thatdoes not become a gameteo. polar body 15. the time during mitosis whensister chromatids…
- The end products of meiosis I are Ca. 2 diploid Cb.2 haploid Cc. 4 haploid cells.In what phase of meiosis would you find no chromatids? Group of answer choices A. telophase 2 B. metaphase 1 C. anaphase 1 D. metaphase 2 E. prophase 12) Name each stage of meiosis in the following diagram: 2. 3. 1. 4. 5. 6. 7. 8.
- Nondisjunction during meiosis I of oogenesis will result in eggs that have Select one: O A. The normal number of chromosomes. B. Only in one less than the normal number of chromosomes. C. Both in one too many and/or one less than the normal number of chromosomes D. Only in one too many chromosomes.Gametes contain one of each kind of chromosome because Select one: O A The homologous chromosomes separate during meiosis. B. Crossing-over occurs during prophase I. C. Only one replication of DNA occurs during meiosis. D. The chromatids separate during meiosis.The stage of meiosis in which chromosomes pair and cross over is:a. prophase Ib. metaphase Ic. prophase IId. metaphase IIe. anaphase II