Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Val-lle-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle O 10

Q: Which of the following amino acids are considered as both glucogenic as well as ketogenic amino…

A: Those organic molecules which possess two functional groups carboxylate and amino group and a…

Q: Write down the abbreviations (both 1 letter and 3 letter) for the amino acids given below:…

A: Amino acids contain an alpha-carboxylic acid group and an alpha-amino group. Glycine is the simplest…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: Multisubunit proteins in which some or all of the subunitsare identical are referred to as…

A: Multisubunit proteins are considered as those proteins, which are composed of more than one protein.…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) Transcription- When…

Q: What will you come up if you need to create a protein sequence that will pe positive to both…

A: Amino acids are any organic molecules that contain an amino group (–NH2) and a carboxyl group…

Q: Reveal the secret message by writing the amino acid sequence into one-letter code: Leu-…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Define the following terms:a. Rieske proteinb. Psa dimerc. D1/D2 dimerd. A0e. A1

A: The biological system can be defined as a system or the group of entities, organs that will work…

Q: A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of…

A: A tridecapeptide is an oligopeptide having thirteen amino acid residues.

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: Give the name of the protein using the three letter symbol. Give the name of the protein using the…

A: Proteins are highly complex bio molecule present in all living beings. They are polypeptides of…

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2…

A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino…

Q: Which peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to…

A: Aromatic amino acids are relatively non polar.  All aromatic amino acids such as tyrosine,…

Q: For each amino acid: [1] give the name; [2] give the threeletter abbreviation; [3] give the…

A: Amino acids are monomers that make up proteins. Amino acids have an amino group and a carboxylic…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: Which of the following sequences is most likely to represent a beta-sheet portion of a protein? O…

A: The β-sheet is a secondary structure motif of the protein structures. it is formed by the β-strands…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: Draw the molecule. B-D-Gal(1 → 3)ß-D-GlycNAc Ta(1 →2) L-Fuc

A: Fucose has the chemical composition C6H12O5 and is a hexose deoxy sugar. It is located on the…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: The change of one conformation of protein to another is called    a. allosteric transversion b.…

A: Option b Allosteric transition

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: Uracil (U Adenine HN 3 H- HO-P-0-P~0-P 0-CH, o-P H H. H H. 5 H OH OH он он 2 O-a-or O-a-or O-a-Or

A: Nucleic acid was first discovered by Fredrich Miescher from the nuclei of the pus cells (leukocytes)…

Q: Identify a disease or condition related to protein mis-folding.  Which protein is misfolded?  Is…

A: Accumulation of misfolded proteins cause disease various neurodegenerative diseases, such as amyloid…

Q: Identify the primary sequence for the polypeptide that yields these fragments upon treatment:…

A: Proteins are the macromolecules composed of amino acids bound together by peptide bond between amino…

Q: Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1,…

A: Beta sheet is one of type of secondary structure in which inter strand hydrogen bonds is formed…

Q: The following are essential amino acids, except; Isoleucine Tryptophan…

A: Proteins are made up of amino acids and each amino acid has different functional group (R- group).…

Q: .Ala-Phe-Lys-Val-Val-Glu rom the above polypeptide, what amino acid/s go/goes inside the cell after…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…

A: The bond between nitrogen and alpha carbon (N-Calpha) in amino acid is known as phi bond. On the…

Q: First Second Letter Third Letter U A G Letter phenylalanine phenylalanine serine tyrosine cysteine U…

A: Gene is present in the DNA. It is made up of sequence of nucleotides. It encodes a protein.

Q: What products are formed when below peptide is treated with chymotrypsin? Phe–Tyr–Gly–Cys–Arg–Ser

A: Three different types of bonds occur in the formation of polymeric biomolecules – peptide,…

Q: Select the amino acid sequence that would most likely be located in the interior of a water soluble…

A: Peptides are composed of a linear chain of amino acid sequences attached to each other via peptide…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: Can you please identify what type of protein this is?

A: The correct answer is "Antiparallel beta confirmation"

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Which amino acid sequence will be generated?  5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'

A: During translation mRNA is translated into amino acid sequence, by the help of various enzymes, tRNA…

Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…

A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…

Q: Which of the following amino acids is/are ketogenic? A. tyrosine and phenylalanine B.lysine and…

A: A carboxylic acid group, a side-chain distinct to each amino acid, and an amine group are the three…

Q: A stock solution contains 0.2 mg/mL protein. From this stock solution, 179 uL is diluted with 1.1 mL…

A: Proteins are composed of amino acid monomers. The protein concentration can be measured in a…

Q: Translate the following amino acid sequence into one-letter code:…

A: The unique one-letter code was developed for easy and fast recognition of amino acids. Each of the…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…

A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…

Q: Consider the following protein sequence as an α helix:…

A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.

Q: Draw the peptide formed between asparagine and histidine. H,N-CH-ċ-OH H,N- -CH—С—он CH2 ČH2 N° NH2…

A: Introduction: Proteins are one of the major macromolecules that helps in the structure and function…

Q: What will you come up if you need to create a protein sequence that will me positive to both…

A: The amino acid and functional group test of protein can be done in different ways out of which…

Q: How many cysteines are present in the amino acid sequence you were given? A.45 B.12 C.60 D.10…

A: Cyteines are one of the 20 amino acids which are ribosomally incorporated into proteins. This amino…

Q: UCAQ UC AG UGA0 UC UCAG GUC UOPO AC Alanine Tyrosine Stop A GU Valine Y Cysteine G A Stop AG AC A G…

A: Genetic Code The genetic code is the relationship between the sequence of basis in DNA or its mRNA…

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Proteins or peptides are a linear chain of amino acids attached together via peptide bonds. Natural…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.