Q: What effect would inhibitors of histone deacetylases have upon transcription? Group of answer…
A: Introduction : The protein histones is very alkaline. In eukaryotic cells, they are located in the…
Q: ob woH svo od bolles et fill de 2. From the information given in the chapter about the ABO blood…
A: Codominant alleles establish the blood type of an individual. The IA, IB, and I genotypes are three…
Q: 1. (a) Compare and contrast the cell wall in bacterial cells, fungal cells and plant cells.
A: A hard, exterior layer created expressly to offer structural strength and stiffness is referred to…
Q: A student wishes to carry out an investigation to determine the role of the drug CORA against MCF-7…
A: Cancer is a broad term used to describe various diseases in which abnormal cells divide and grow…
Q: Using pencil, you will draw a representation of DNA replication along the leading and lagging…
A: DNA replication is the process that occurs in all living organisms replicate their DNA during…
Q: Describes the effect of tissue dehydration on cellular function provide citation and reference.
A: Histological processes evaluate tissue. It consists of different steps. In this process, tissues are…
Q: What is the meaning of the term Flora and Fauna?
A: Introduction Biogeography pertains to the spatial and geological distribution of different animals…
Q: What is insect farming?
A: Insects are among the most diverse animal species on earth, and it is incredible to see how they…
Q: (b) Compare the modes of transmission of Amebiasis and Giardiasis.
A: Disease transmission refers to the spread of disease from one person or organism to another. It can…
Q: Fishy proteins Cod fish have two alleles for a protein that binds oxygen, called the Hb-1 and Hb-2…
A: Understanding life and its diversity has been centered on how natural selection has shaped the…
Q: 12. During asexual reproduction, genetic drift cannot affect the population's evolution. O True O…
A: IntroductionMitosis is the basis for reproduction by one parent → asexual reproductionCommon in…
Q: #1. Answer 1a, 1b 1a. Is the Philippines connected to Borneo during the Pleistocene period? 1b. A.)…
A: The study of the distribution of organisms and ecosystems in geographic space and during geological…
Q: THE SPECIATION OF THE TWO MOST COMMON FUSOBACTERIUM PATHOGENS CAN BE ACCOMPLISHED BY WHICH…
A: In microbiology, Fusobacterium can be described as a genus of gram-negative bacteria which thrives…
Q: Differentiate between the coronary, pulmonary and systemic circulation.
A: Circulation is one of the most important physiological processes of the body. We know that blood is…
Q: What are the formulating ingredients used in nicotine chewing gum? Please answer at your own easy…
A: Nicotine chewing gum is used for the cessation of smoking habit. It helps to decrease the withdrawal…
Q: If two heterozygous individuals that carry an allele that is 75% penetrant in the heterozygous…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Which pattern of inheritance is associated with a trait that in about one-fourth of the children,…
A: The question claims that both males and female children acquire the feature. As a result, the sex…
Q: 18. Which of the following is not involved in signal transduction by the beta-adrenergic receptor…
A: Introduction:- Cell signalling is the process by which a cell recieves and respond to the signals…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: Please consider Figures, 10.28, and Table 10.2 (attached), which contain data that were collected by…
A: Field tests revealed that age, rather than pollination, is what causes the green-to-red colour…
Q: Construct a model that demonstrates how energy is captured in the light dependent reactions of…
A: The mechanism through which plants convert carbon dioxide, water, and sunshine into oxygen and…
Q: # 1. Match the following with the correct type of ecology: Use checkmark Population Community…
A: Ecology is the study of the interaction of living organisms with each other and with the…
Q: Based on the results of your chi-square test, briefly explain whether your observed numbers and your…
A: The Chi-Square statistic is used for testing relationships between categorical variables. If it is…
Q: 3. Protease inhibitors, O inhibit processing of long polypeptide chains O inhibit reverse…
A: Introduction A substance that increase the rate of a reaction or catalyze a reaction without being…
Q: The induced-fit theory aims to explain how the interactions between an enzyme and a sub- strate…
A: Enzymes are highly specific biocatalysts. Enzymes are specialized proteins or sometimes RNA which…
Q: Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these…
A: Introduction : Ethylene is one of the plant growth regulators. Ethylene hormone inhibits the growth…
Q: Briefly explain How does post-transcriptional regulation work in prokaryotic and euk
A: Post-transcriptional regulation is essential for controlling gene expression in highly dynamic…
Q: The activity of cyclin dependent kinases is regulated by: A Their concentration inside the cell B с…
A: Cyclin dependent kinases (CDKs) are a family of proteins that act as molecular switches to control…
Q: e. On the stretch of mutant viral RNA below, draw translation in progress. Draw the following: ●…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…
Q: Which of the following statements is most directly described by the first law of thermodynamics? A B…
A: First law of thermodynamics is a kind of energy conservation law which states that energy can…
Q: which of the following correctly describes how protein kinase A can activate genes? A: nuclear…
A: By activating cAMP-dependent protein kinase-A (PK-A), which is activated when cAMP binds to the…
Q: Which of the following is a product of glycolysis that is transported into the mitochondria?…
A: Glycolysis is the process by which one glucose molecule is transformed into two pyruvate molecules,…
Q: DNA is pretty important because it is instructs what proteins to make. the energy producer in a…
A: Introduction DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in…
Q: Does chromatin compaction increase or decrease as DNA methylation increases?
A: DNA methylation favours the heterochromatin state and reduces overall DNA flexibility while…
Q: 6. In two or three sentences, describe how scientists identified these genes. 7. Why do you think it…
A: Suppose a gene alteration raises the chance of high blood pressure, but no one knows where that gene…
Q: Part A: Antibiotic resistance is a major health concern. Resistance to various antibiotics can be…
A: Antibiotic resistance occurs when bacteria develop to evade the effect of antibiotics by different…
Q: 7. At various times since the 1950s, scientists in the UK and Canada have been involved in…
A: Introduction Tagging is used to obtain different information. Migration patterns and Habitat use are…
Q: 20. A heterozygous fish that simultaneously expresses Hb1 and Hb2 alleles would pay an energetic…
A: If a fish receives a different copy of a gene from its father than it does from its mother, the gene…
Q: 3. An unvaccinated patient was bitten by a dog potentially infected with the rabies virus. What…
A: A certified veterinarian must provide rabies vaccination to the animal between the ages of 3 and 4…
Q: prilliscutes to bedtag 2. In 1919 a researcher by the name of Dahl wanted to estimate the number of…
A: Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: How does the rabies virus spread through the human body after a bite?
A: Introduction : Viral rabies is a deadly illness. The rabies virus can be carried by animals such as…
Q: The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber…
A: In order that a polypeptide is formed from a DNA sequence, two processes are required to take place.…
Q: This is the growth curve for Clostirdium (incubated under optimal growth conditions). Use it to…
A: There are 5 phases to a logistic (sigmoidal) growth curve. They are stationary phase, lag phase,…
Q: Unripe fruits are hard and tart. Ripening is a process that sweetens and softens the fruit to make…
A: A positive feedback loop accelerates ripening when ethylene is present because it encourages the…
Q: Which of the following occurs during synaptic transmission? Select ALL that apply A) vesicles…
A: Introduction : A synapse is the point at which two neurons come together, or between a neuron and a…
Q: 1. a) List 5 distinguishing factors of reptiles and their similar characteristics to birds. b) How…
A: Birds and reptiles are two different groups of animals that are quite different from each other yet…
Q: In January 2010, a population of organisms had a size of 564. By the end of the year 109 of those…
A: In january 2010 , population of organisms had a size of 564 By the end of the year 109 had died so…
Q: Based on the knowledge acquired about the conservation and propagation of microorganisms, propose…
A: Yeast is a eukaryotic organism that belongs to the fungus kingdom. It is single-celled and is used…
Q: Describe (at the cellular level) how detergents like ostrasan and SDS (from solution 2 in the…
A: The molecular method for isolating plasmid DNA from bacteria is called plasmid extraction. This…
Step by step
Solved in 2 steps
- the task is to use this image to write a results section of a report about: Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq. 1000 words would be bestProvide a brief summary (3 – 5 sentences) about information of the GATA3 gene (frequency of mutations, types of mutations, details of patient data such as health symptoms expressed due to the mutated gene above , etc.).Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?
- Identify the term that best matches the definition or description given. in vitro reproductive cloning therapeutic cloning gene embryo cloning transfer fertilization producing genetically identical cells producing multiple copies of a single gene placing a zygote into a uterus producing genetically identical individuals combining egg and sperm outside the female's bodyTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?the context of this image is that it is from the GEO website and what to do is to write 500 words for the results section of a report using the image. the title is Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq
- Describe the ethical issues encompassing germ line gene therapy in 150 words.Explain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the diagnosis of sickle cell disorder . Would you recommend this method for routine diagnosis of sickle cell disorder? ExplainAnswer the following questions : 1. Stem cell treatment has been a subject of debate since the early 21st century. What do you think about the current developments in stem cell treatment? 2. What health conditions do you think urgently need to be treated by gene therapy? Why?
- Write and discuss about the analysis procedure used for carrier screening for the single-gene diseases that is routinely conducted in different countries. (Subject: Genetic engineering).Identify the technology portrayed by the example. Match the number to its corresponding letter. Example Technology used 1. Production of human growth hormone using genetically modified bacteria. 2. Creation of CoVid-19 vaccines that make use of viral vectors such as AstraZaneca and Sinovac. 3. Introduction of the normal CF gene to cystic fibrosis patients using adenoviruses as vectors. 4. The first bird genome to be sequenced is that of the chicken, Gallus gallus. It was completed in February 2004. This databank has been useful in the study of human diseases transmitted from birds such as the Avian flu. 5. Starting 1998, Apligraf, an engineering artificial skin has been used to replace the traditional skin grafts. a. Xenotransplantation b. GMOs as Biofactories c. Stem cell and tissue engineering d. Gene Theraphy e. Cloning by embryo splitting or nuclear transfer f. Genome projects h. Vaccine development in a shorter time framewhat is the frequency of the rarest variant you can detect during deep sequencing of a tumor cell if you coverage is 250X? - 0.5% - 0.4% - 25% - 4%