Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). celllo All 1177 ****77777 Align and score 4 optimal alignments here. Each alignment should have h sequence in the first line, v sequence in the second line and individual scores for each alignment position in the third line.
Q: Why do some starch products set as they cool?
A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…
Q: Thick filaments are part of the I band contain actin O contain myosin but thin filaments do/are not.…
A: In each microfibril, actin thin filaments and myosin thick filaments are organized into a linear…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP site is Apurinic site or Abase site at which nitrogen base is lost from the nucleotide of DNA and…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…
A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM
Q: Determine the chemical formula for the following molecules by counting the Carbon, Hydrogen and…
A: Introduction : Carbohydrates - Also known as carbs, are sugar molecules which consists of…
Q: (c) ( To identify the critical enzyme resi- due:substrate interaction and determinant of sub- strate…
A: Phosphotyrosine protein phosphatases (PTPases): These are a group of enzymes that catalyze the…
Q: Which of the protein purification methods listed below is the first step one needs to take after…
A: Introduction: Protein purification involves the separation and purification of proteins from a…
Q: Mnemonic about the UREA CYCLE that is not from the internet. Thank you.
A: Urea cycle is also known as the Ornithine cycle. In urea cycle urea is produced from ammonia. Urea…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: You start with 100 units of protein activity and 100 grams of total protein. After the first…
A: Protein purification is performed to purify a target protein from a mixture of proteins. Fold…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: What is the role of ribose in Central Dogma of Molecular Biology?
A: The information stored in the DNA flows to RNA and is then used in the synthesis of proteins. This…
Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…
A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…
Q: Cyt cb562 will form a tetramer in the presence of Zn+2 or in the absence of Zn+2, it will form a…
A: INTRODUCTION : Cyt cb562 - Cytochrome cb562 is a variant of an Escherichia coli four-helix bundle…
Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…
A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Explain how RNA Pol II switches from strand initiation to strand elongation
A: RNA Polymerase II is a mulit-iprotein enzyme that transcribes DNA to messenger RNAs. RNA Pol II…
Q: How is aquaporin synthesised? List step by step. How is this protein made and targeted to its final…
A: Aquaporins (AQP) are protein channels that function in the transfer of water at very high rates…
Q: Which of the following statements about oxidative phosphorylation is correct? OH* ions are…
A: Introduction ATP is synthesised in the mitochondria of a cell by a process called oxidative…
Q: In the degradation of glycogen, the purpose of the debranching enzyme is to remove the last four…
A: Glycogenolysis is the breakdown of glycogen into glucose by a set of enzymes. The key enzymes of the…
Q: Define the planted motif search problem.
A: INTRODUCTION : A sequence motif - This sequence motif is a nucleotide or amino acid sequence pattern…
Q: What are the essential amino acids and how does the body get them? Give an example of one of them…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: The prokaryotic cell is simple, not complex as the eukaryotic cell. In eukaryotic cells, the site of…
Q: HN 2 H₂N-C C 6 3 N C 5 C following nitrogenous bases is represented by this structure? 7 ZI 8 CH
A: The nucleic acids are constituted of nucleotides. The nucleotides consist of a base (adenine,…
Q: Process: State (at right)
A: The cell membrane is composed of a phospholipid bilayer. The proteins embedded in the membrane (…
Q: More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative…
A: Degradation of glucose is termed as glycolysis which is a catabolic pathway in which 6 carbon…
Q: Question 11 of 25 Among the given statements, which are characteristics of plant cells? Select the…
A: Osmosis is the process of net movement of water across a semipermeable membrane This transport…
Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…
A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…
Q: Question 23 of 25 Among the given statements, which ones describe the lysosomes? Select the correct…
A:
Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: 7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?
A: mRNA is called messenger RNA. mRNA act as a transcript for the synthesis of peptide or proteins.…
Q: The following proteins were separated by SDS-PAGE in the presence of mercaptoethanol. Sketch the…
A: SDS-PAGE is an electrophoretic technique that separates proteins based on their size. This method…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…
Q: Question 9 Which of the following fatty acid does have greater solubility in wat O 16:0 O 18:0 O…
A: Fatty acids are a class of lipids that are nonpolar and are insoluble in water. The naturally…
Q: Which one of the following statements about PEP (phosphoenolpyruvate) synthesis is correct? Pyruvate…
A: PEP, also known as 2-phosphoenolpyruvate, is a crucial biochemical intermediary. It participates in…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: Many proteins that remain homogeneously distributed in water have molecular masses in the range of…
A: A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size…
Q: Which of the following substances can deliver electrons to the ETC to help pump out H+ across the…
A: Electron transport chain is a chain of electron carriers that transfer electrons to molecular…
Q: 3. Briefly describe and explain the shape of the curve in Q2.
A: In an enzyme-catalysed reaction, the substrate binds reversibly to the enzyme's active site to form…
Q: What is epistasis, and what is pleiotropy? Describe with examples.
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: n which of the test tubes would you say hydrolysis has taken place in this experiment? Why?
A: Enzymes are large molecular weight proteins that catalyse biochemical reactions. The substrate bind…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: Which of the following are true about oxaloacetate? It can cross mitochondrial membranes It is an…
A: Glycolysis is a pathway which breaks down glucose into two three-carbon compounds and produces…
Q: H ОН CH2OH D H ОН H 0 البلاد - ОН H CH2OH H H ОН H 0 ОН Which of the following statements correctly…
A: The sugars often contain alcohol and carbonyl functional groups and the intramolecular hemiacetal…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool Best Local Alignment Search Tool Best Local Algorithm Search ToolFor letter A, pls ILLUSTRATE (create an illustration or drawing) the DILUTION SERIES of the problem just like the sample on the 2nd image. Please read the instructions carefully as I have already posted this twice and the experts just copy-pasted the answers from my first post. I don't want to waste another post question for this one. Again, I NEED AN ILLUSTRATION and not just the computation/explanation through words so I can properly visualize the problem. WILL UPVOTE if I get what I need.Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000
- Which of the ff is incorrect?Horizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. NW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the NW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following…Draw the Haworth projection of B-L-altrose. You will find helpful information in the ALEKS Data resource. Explanation 2 Check # 3 Click and drag to start drawing a structure. $ 4 % 5 80 6 :: & 7 X S * 00 to v © 2023 McGraw Hill LLC. All Rights Reserved. Terr ( 9
- Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATTHorizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following points…If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
- Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. NW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the NW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible AlignmentDescribe the process of doing a microarray. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 ( BIUS. Paragraph Ari132624252274557919.docx (Protected View) - Word Safa Mushtaq File Home Insert Design Layout References Mailings Review View Help O Search A Share A PROTECTED VIEW Be careful-files from the Internet can contain viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editing (b) Following figure is showing the DNA fingerprint analysis on the one locus of a man with four children. Which lane contains the DNA of a father? Why did you select that lane? 1 4 A Page 1 of 2 454 words 130% 8:25 PM G A ENG 4/9/2021