A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature MRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)

A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature MRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)

Name: Molecular Biology (Biol-L211)Dr. NoleCentral Dogma Practice - Process
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Molecular Biology (Biol-L211)Dr. NoleCentral Dogma Practice - ProcessesThe general flow of genetic information is diagrammed below. Think carefully about what type of molecule isrepresented by each item in the diagram and clearly address each of the

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%
B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?
A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)
a. 0.02z3 ML Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-MRNA leaves the nucleus; 3- TRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-TRNA anticodon links with mRNÁ codon; 6-polypeptide chain completed; 7-MRNA binds to ribosome; 8-mRNA transcibed Select one: a. 6-5-7-3-2-1-8-4 b. 4-2-8-3-7-5-1-6 c. 1-8-6-7-5-3-4-2 d. 4-8-2-7-3-5-1-6 e. 1-2-3-4-5-6-7-8 When using the high power objective, you should not adjust the Select one:
C. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for analysis and writing your answers) PERFORMANCE TASK-SAY IT WITH DNA: PROTEIN SYNTHESIS Directions: 1. Build the correct mRNA molecule by transcribing the template DNA strand. 2. Figure out the TRNA triplets (anti-codons) that would fit the mRNA triplets (letter by letter). 3. Translate the MRNA codons and find the correct amino acid using the Codon Wheel on page 1. 4. Write in the amino acid (abbreviation) then, record the one-letter symbol of the corresponding amino acid. If you do this correctly, the symbols should spell out a meaningful message in English. Note. "Stp" = "space" (no equivalent symbol, leave it blank) MRNA DNA -> TRNA T А U G A -> A -> Here is a partially solved message... Decode the rest of the message. TT CTT DNA message code CTT | GGG ACT TAG AGC ATT CCT GCC CTT CGA TGC MRNA CUU AUC UUU GAA UGA AUC TRNA GAA UAG AAA CUU ACU UAG Amino Acid abbr. (based on MRNA) Leu Ile Phe…
Concept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::
BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
BMD 101: Biochemistr ... Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a new codon still coding for the same amino acid Select one: O True O False ge OUS ACTIVITY RNA Lecture Jump to..
Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil molecules. The DNA molecule that was transcribed to form the mRNA sample would most likely contain Select one: a. 18% adenine b. 18% cytosine c. 32% thymine d. 32% adenine O O O
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.