Q: Match the hormones involved in calcium homeostasis below with the glands or organs that secrete them...
A: Calcium homeostasis refers to the maintenance of a constant concentration of calcium ions in the ext...
Q: Recall p + q = 1 p2 + 2pq + q2 = 1 p is the frequency of t...
A: If the alleles and genotype frequencies remain same in a population generation after generation then...
Q: Create a pictogram and put a specific domestic crop and show the evolution with explanation.
A: Introduction: Evolution is the change in the inherited characteristics of biological populations ove...
Q: MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis ...
A: 1. Ongoing quantitative PCR for HBV DNA DNA was extricated from 200 μL of serum utilizing the QIAamp...
Q: Genetic engineering of plants provides an opportunity to alter their properties or performance in or...
A: Genetic engineering is a technique that is utilized to change the genetic matter of the individuals ...
Q: What is the phenotype and genotype of offspring in the following conditions? (use the Punnett square...
A: ABO blood group system consists of four types of blood groups - AB, O, A and B. ABO blood group is a...
Q: At each origin of replication, DNA synthesis proceeds bidirectionally from two replication forks. Wh...
A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA molecu...
Q: What does it mean to find two different species are found in the same layer
A: Species It refers to the group of living organisms that involves similar individuals that have the a...
Q: Distinguish between polyploidy and aneuploidy
A: A chromosome is a tiny thread-like structure found in the nucleus of eukaryotic cells (animal and pl...
Q: are the gene pairs in non allelic interaaction, recessive epistasis independently segragating?
A: Epistasis:The interaction of genes that influence phenotype" Epistasis is a phenomenon in genetics ...
Q: For fruit flies, N=4 and 2N=8 a. Sketch a dividing fruit fly cell which is in prophase I. b. Sketch ...
A: NOTE: Since you have asked multiple questions So we will solve the first par for you. as per our com...
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...
A:
Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...
A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...
Q: What do we use to try and understand the state (and quantity) of nature? What are some challenges...
A: Definition Nature is defined as the natural Earth and the things on it, or the essence of a person o...
Q: Q6.1. What is the founder effect? Sampling error that occurs during the establishment of a new popul...
A: Introduction :- The founder effect is the loss of genetic variation that happens when a new populati...
Q: In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of genoty...
A: Part A. In the question given that - "initially the treated recipient populations placed on a minima...
Q: Describe how you would experimentally demonstrate that a specific G beta protein subunit is required...
A: Cells communicate with each other via released proteins unique to each kind. Signal transduction pat...
Q: the treatment that utilizes transgenic organisms to mass-produce proteins O stem cell therapy O gene...
A: Recombinant DNA technology plays a major role in modifying the genetic setup of an organism to have ...
Q: What is Arthrobacter luteus ?
A: Prokaryotes are organisms with no well-defined nucleus.
Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...
A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...
Q: 1: Where was the Nariokotome Boy Found? How long ago did he live? How old was he? 2: What species do...
A: Nariokotome Boy or Turkana Boy:- About 1.8 million years ago, a boy died and this specimen is the mo...
Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...
A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: Research have stated that there are factors that could affect the efficacy and duration of mosquito ...
A: *Mosquitoes are vectors for mamy diseases like malaria and chikungunya abd Zika virus and yellow fev...
Q: Which of the following statements does NOT describe Darwin's theory of natural selection A. Member...
A: * Natural selection is the mechanism in populations of living organisms adapt and survive best. *Spe...
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...
A: Introduction :- Escherichia coli (E. coli) is a type of bacteria that can be found in the environmen...
Q: 3. What's the difference between chronological age and biological age?
A: Introduction The length of time that someone or anything has lived or existed is referred to as thei...
Q: Explain the terms "methylase," "methylates" and "methylation"
A: METHYLASE:- A methylase is the enzyme that recognizes a specific sequence and methylates one of the ...
Q: human cheek cells
A:
Q: 1. Why are protist, plants, fungi and animals classified into the same domain but into different kin...
A: Introduction All plants, animals, and microbes on the planet are included in taxonomy, which is the ...
Q: How does the vegetal stratification of an ecosystem influence its biological diversity?
A: Im this question we will discuss about how the vegetal stratification of an ecosystem influence it's...
Q: Cure for Beriberi In 1887, a strange nerve disease attacked the people in the Dutch East Indies. Th...
A: Observations: The victims showed the following symptoms; weakness and loss of appetite. Moreover dea...
Q: in only one cell, label the nucleus, cytoplasm, and cell membrane for these two figures. Describe th...
A: 1. It is simple cuboidal epithelial cell , it is located at lines kidney tubules. Nucleus is presen...
Q: In your own understanding, Indentify the hurdles that may help to lengthen the shelf-life of squash ...
A: The shelf- life of a product depends upon the condition in which the product is being placed. Better...
Q: answer the question. The bombardier beetle is spraying a boiling hot liquid that contains irritating...
A: Introduction: Beetle is considered to be the gardener's friend and it is a fearsome predator as it c...
Q: how they can affect the populations
A: Ecology at the organismic level is essentially physiological ecology which tries to understand how d...
Q: asystole
A: The cardiac cycle is the performance of the human heart from the beginning of one heartbeat to the b...
Q: Using any search engine, look for at least three (3) processes of Plants and Animals: reproduction, ...
A: Both animals and plants uses various organ systems to perform different functions for their survival...
Q: The theory of endosymbiosis explains how or why ○ free living bacteria became Eukaryotic organelle...
A: Answer : the theory of endosymbiosis explains that : free living bacteria became Eukaryotic organel...
Q: What is the shape and arrangement of the palisade mesophyll in the dicot leaf? (b) What is the shape...
A: Structure of leaf Leaf is a structure involved in photosynthesis, General structure of leaf consist...
Q: Match the effector organs for growth below with the goal of their response. (Choose] liver growth in...
A: Several tissues and organs utilizes different functional aspects to grow. Some utilizes energy and s...
Q: Compare the structures of DNA and RNA.
A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...
Q: Choose any microorganism from the different groups of cellular and acellular and give the scientific...
A: Introduction:- Bacteria, fungus, archaea, and protists are examples of microscopic creatures. Microo...
Q: What are pioneer species? What is the role of pioneer species?
A: What are pioneer species? Hardy species that are the first to inhabit previously biodiverse steady-s...
Q: What is the difference between primary ecological succession and secondary ecological succession?
A: In this question we have to write the difference between primary ecological succession and secondary...
Q: Male Reproductive System: Complete the table Letter Structure Function A А prostate gland I B В vas ...
A: Introduction: • The prostate gland is a chestnut-shaped gland located between the bladder and penis ...
Q: Question 5
A: Answer to Question 1: - Sequence of passage of molecule for filtration in kidney: - Blood> Capill...
Q: Both rhodopsin in vision and the muscarinic acetylcholine receptor in cardiac muscle are coupled to ...
A: Receptors receive the signaling molecules that bind to them.
Q: 11 The cell membrane is composed of phospholipids. How do the phospholipids arrange themselves withi...
A: Introduction :- The cell membrane is also known as the plasma membrane. It is the membrane that can ...
Please answer fast
A frameshift is caused by ________ mutations.
missense and nonsense
nonsense and deletion
deletion and insertion
insertion and nonsense
missense and insertion
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Question 9 Review concepts 21.5-21.6. Match term and its description. the mechanism contributes to polyploidy | Choose ) rearrangements of parts of genes due to meiotic errors |Choose one or multiple copies of a gene or genetic regions at loci in some | Choose J humans consequence of duplication, rearrangement and mutation of DNA [Choose JMutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- ______________ is a kind of spontaneous mutation that results from a short-term, reversible phenomenon that leads to abnormal base pairing during DNA replications, followed by another round of DNA replication which results in one of the two daughter DNA molecules containing a point mutation. Group of answer choices Tautomeric shift Frameshift mutation Nonsense mutation Pyrimidine dimer Conditional mutationTransposable elements are short segments of DNA, presentin ___________ locations, that move around the genomeThe kind of mutation where a stop codon is inserted and a protein is not completely made. _______
- The “start” codon is ____ - ____ - ______Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGCFrameshift mutation _____________________ Select one: can result in a completely new codon sequence that results in the production of non-functional proteins. applies to the reading frame (sequence of codons) being changed. All of the choices are correct. most of the happen when one or more nucleotides are inserted or deleted from the DNA.
- Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionOriginal DNA Sequence: T A C G C A A A A A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Mutated DNA Sequence # 1: T A C G C A A A A A T T G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _________________________________ ______________________________________________________________________________________________What type of mutation is it? _________________________________________________________________Mutated DNA Sequence # 2: T A C G C A A A G A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _______________________________________________________________________________________________________________________________What type of mutation is it? _______________________________________________________________________Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNA