4. Draw the number of fragments as well as their sizes as they would migrate on theelectrophoresis gel. Write the size of the fragments on the square when you draw them.LadderSal IHae IIEco R1bp50,00024,00020,00016,00010,0009,0008,0007,0006,0005,0004,0003,0002,0001,000DNA migration

Sal1 is a restriction endonuclease i.e it cleaves DNA at the recognition sequence 5'-G/TCGAC-3'…

Answered: 4. Draw the number of fragments as well…

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter16: Human Genetics And The Human Genome

Section: Chapter Questions

Problem 4TYU

See similar textbooks

Similar questions

A plasmid is a circle of ___ . a. RNA b. DNA c. either RNA or DNA d. histone proteins
Linkage analysis. is used to create a physical map is based on the natural recombination process requires radiation hybrid mapping involves breaking and rejoining of DNA artificially
Match each term with the most suitable description. ______ DNA profile a. GMO with a foreign gene ______ Ti plasmid b. alleles commonly have them ______ probes c. unique array of short tandem repeats ______ SNPs d. used to find clones. ______ transgenic e. mouse vs. human ______ genomics f. used in plant gene transfers ______ CRISPR g. based on RNA interference
1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size in bp is displayed along the top. 100 150 200 250 300 350 D8 Identifiler TM k 2000 multiplex STR TH01 1500 D13 D19 D5 VWA ТРОХ D16 CSF AMEL D3 D21 FGA 1000 D18 D7 D2 500 How do the multiplex STR data demonstrate the profile is from a man? Which loci are homozygous? How do you know this? How does the IdentifierTM kit differentiate D19 and D3 PCR products? How does the IdentifierTM kit differentiate D5 and FGA PCR products?
y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H
3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: Length of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: basepairs (ignore ends with unpaired bases) Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) 4. You are given a new sample of DNA that matches one of the uncut samples above (1, 2, or 3). How could you use restriction enzyme analysis to match your unknown sample to one of the known samples (1, 2, or 3)? Explain below.
The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the template strand based on the pattern in this gel А с G T
10. Samples were tested for sickle cell disease by PCR. The results were analyzed by agarosc gel electrophoresis. Lanes I, 3, 5, 7, and 9 are PCR-amplified, but undigested DNA (364 bp), and lanes 2, 4, 6, 8, and 10 are Ddel-digested DNA. Lanes 1&2 are from a known carrier DNA (B^/B", 4 bands). Please, identify the genotype in lanes 3&4, 5&6, 7&8, 9&10. DNA marker 1 2 3 4 5 6 7 8 uents 10 364 bp- 291 bp- 201 bp- bp CKO BA/Bs
Question Image hown bele nallest? Q. A gel from gel electrophoresis is shown below. Which DNA fragment is the smallest? B. Direction of Travel
1. What are restriction enzymes and what do they do? 2. Complete the chart Original DNA sequence 5' TGA CCA CTC GAG CAT AAC GAG TCG CTC 3° Write the complementary strand's sequence * remember it will be opposite directionality (the number at the ends are different) * pairs are A-T and C-G |Copy and paste your double stranded DNA into this box. You are going to use the restriction enzyme Xhol. Mark the cut site by changing the color (highlight or change text color) of one double-stranded piece * it cuts between the C and the T (cut shown as slash symbol): 5’ C/TC GAG 3' * remember it cuts BOTH strands (the restriction site is palindromic). Hint: read each strand in the 5'à 3' directions to find the cut site
ment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein
a 1. Shown here is a Holliday junctionWhich cut and resolution will result in recombination? d 2. In genetics lab, 2 students infected a samnle of bhacteria with a virur

SEE MORE QUESTIONS

Recommended textbooks for you

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Biology (MindTap Course List)

Biology

ISBN:

9781305112100

Author:

Cecie Starr, Beverly McMillan

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS