3. In vitro experiments are conducted at pH = 7.4 to simulate physiological conditions. A phosphate buffer system is often used. H₂PO H₂РO+H+ ркA = 7.2 a. What must be the ratio of the concentrations of HPO to H₂PO ions? b. What mass of NaH2PO4 must be added to 500.0 mL of 0.10 M Na₂HPO4 (aq) in the preparation of the buffered solution?
Q: 3. At what age or time in life does an individual acquire the antibodies against ABO antigensother…
A: 3. Individuals typically acquire antibodies against ABO antigens other than their own during the…
Q: A polysome is actively involved in translation. The ribosomes are attached to which of the…
A: The question is asking to identify the molecule to which ribosomes are attached during the process…
Q: Which of the following statements regarding hemoglobin (Hb) saturation are true? a. On top of…
A: The question is asking us to evaluate the truthfulness of several statements about hemoglobin (Hb)…
Q: DNA Structure A. Draw an A-T base pair with the appropriate number of hydrogen bonds. You don’t have…
A: A. Adenine (A) Thymine (T) | | | | -N-H---O=C…
Q: Sarah is trying to build muscle, so she wants a high-protein drink, but she is also…
A: 3. Soy milk6. LactaidExplanation:2% Cow's MilkA lactose intolerance would not be appropriate for…
Q: In what direction(s) did the brain evolve? How do we know which structures are "newer" in an…
A: Brain Evolution Direction and Dating MethodsBrain evolution is a fascinating story of growth and…
Q: Most genetic mutations are deleterious, producing negative effects. True or false?
A: The objective of the question is to determine whether most genetic mutations are harmful or…
Q: Observed numbers of mosquitoes by kdr genotype +/+ +/r r/r A. gambiae Pre-2006 3 5 2 2006 8 8 7…
A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…
Q: Match the muscle type to its main characteristics Smooth muscle Cardiac muscle Skeletal muscle…
A: Match the following
Q: Q6.3. Imagine two new volcanic islands spring up in the middle of the ocean. Each island is quickly…
A: A hypothetical ecological situation where two new volcanic islands emerge within the sea, each…
Q: what mechanism, during evolution, is most likely to have arisen
A: During evolution, the mechanism most likely to have arisen is natural selection. Natural selection…
Q: Is tiktaalik more closely related to ray-finned or lobe-finned fish?
A: The question is asking about the evolutionary relationship between Tiktaalik, a prehistoric…
Q: The most frequent cause of a nonmalignant increase in total leukocyte count is Question 1…
A: The objective of the question is to identify the most common cause of a nonmalignant increase in…
Q: What is the relationship between a pioneer species and primary succession? A…
A: The objective of the question is to understand the relationship between a pioneer species and…
Q: a) Let's say the two motif hits (CCACGAG and CCGCCAG respectively) turn out to be evolutionarily…
A: Motifs are mainly short, conserved sequence patterns that are associated with specific function of a…
Q: Which of these statements about carbonic anhydrase is incorrect? Question 17Answer a. It…
A: The objective of the question is to identify the incorrect statement about carbonic anhydrase, an…
Q: what is the foot segment displacement from the mid stance phase (35%) to mid swing phase (80%) of…
A: The gait cycle could be a complex sequence of movements that happen amid walking, including…
Q: Why are fruit flies good subjects with which to observe the process of evolution through natural…
A: The objective of the question is to understand why fruit flies are often used in studies of…
Q: QUESTION 1 In cucumbers, warty fruit (W) is dominant to smooth fruit (w) and dull fruit (D) is…
A: In the field of genetics, understanding how traits are inherited is often studied through crosses…
Q: NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part II - Influenza in a Boarding School Note:…
A: Part II - Influenza in a Boarding SchoolQuestion 1: Adjusting Transmission Coefficient (ẞ) and…
Q: Observation of a hematoxylin and eosin- stained microscope slide reveals that the nuclei are blue.…
A: The objective of the question is to understand the reason behind the blue color of nuclei in a…
Q: It is the holidays and you have just finished eating a large meal with your family. Now, you retire…
A: The parasympathetic nervous system (PSNS) and enteric nervous system (ENS) and their roles in…
Q: what is the difference between biomass and waste biomass and how waste biomass is harmful to…
A: a)Biomass refers to organic materials derived from plants and animals, such as wood, crops,…
Q: 1. A new species of animal called the rekamriliob has been found in the wild. The lab you work in…
A: Explanation: Since the genes for coat color (P/p) and limb thickness (T/t) are unlinked, they…
Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…
A: The objective of the question is to identify which of the given options is an example of…
Q: Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid…
A: Mutation #3:DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC5'mRNA transcript sequence: 5' AU…
Q: The cell in the center of the electron micrograph above is important in wound healing and plays a…
A: The question is asking us to identify the type of cell that is important in wound healing and plays…
Q: Does the intake of acidic or alkaline foods affect the blood pH? a) No, the blood pH fluctuates…
A: The correct answer is: b) No, the blood pH is constantYour body has a very strong buffering system…
Q: Define R0 and provide an example of an infectious agent with a high R0 compared with an infectious…
A: R0 means the basic reproduction number. This represents the average number of secondary infections…
Q: Select the statements below that are TRUE. Select 4 correct answer(s) Question 14 options: A)…
A: This question tests your understanding of various genetic phenomena:Mutations: Spontaneous changes…
Q: Mammal-like reptiles like Gorgonopsid had specialized teeth, different from the uniform peg-shaped…
A: The question is asking whether the mammal-like reptiles, such as Gorgonopsid, had specialized teeth…
Q: Which of the following cells share a common progenitor cell with macrophages? a)Astrocytes b)…
A: The question is asking us to identify which of the listed cell types shares a common progenitor cell…
Q: Place the stages of the fruit fly life cycle in the correct order. Rank the options below. Adult…
A: life cycle of fruit fly in order:fertilized eggfirst instar larvaesecond instar larvaethird instar…
Q: Given the allele frequencies below, what would be the expected genotype frequencies in the next…
A: The link between genotype and allele frequencies in a population is described by the Hardy-Weinberg…
Q: Subject: Environmental Physiology Please answer both parts of the question
A: (i) The graphs show how temperature and photosynthesis relate to three different plant species: a,…
Q: During preoperative period, the nurse is interviewing the client. The nurse will report to the…
A: The objective of this question is to identify which medications a patient is taking that should be…
Q: At prophase of meiosis 2, how many chromosomes will be in a cell from the same organism as this…
A: Meiosis is a cell division in which a diploid cell divides to form four haploid daughter cells. It…
Q: Question for assignment: Using a transgenic technique, propose an experiment to determine whether…
A: The objective of this question is to design an experiment using transgenic techniques to determine…
Q: What role do transcription factors play in transcription?
A: The process of copying genetic information from DNA into a complementary RNA molecule is called…
Q: for acrolein taint to occur glycerol is metabolized in the presents of _ _ _ _ _ _ _ _ _ _ _ _ _ _…
A: Acrolein taint refers to an undesirable off-flavor caused by the presence of acrolein in a food or…
Q: State how salinity of soil can be measured?
A: The salinity of soil can be measured using various methods, including: Electrical Conductivity (EC)…
Q: 48) Sleeping sickness is caused by: a) Unicellular organism b) Eukaryote c) Protozoan d) Parasite e)…
A: Sleeping sickness, also known as African trypanosomiasis, is a potentially deadly parasitic disease…
Q: 24-year-old delivery driver is involved in an accident and sustains a wide abrasion over his left…
A: The objective of the question is to identify the mechanism that allows for the restoration of the…
Q: can i have this in more detail please
A: Tinnitus is a common auditory phenomenon characterized by the perception of sound within the absence…
Q: Two nonhomologous chromosomes have the following segments, where * represents the centromere:…
A: Two nonhomologous chromosomes have the following segments, where * represents the…
Q: A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157…
A: To draw the structure of the hybridized mRNA and estimate the size of the protein coded for by this…
Q: A SNV mutation that results in no change in the amino acid sequence is called: A. silent mutation…
A: A mutation is a permanent alteration in the DNA sequence of an organism's genome. DNA, or…
Q: Autophagy Is Required for PKA Activation and Cell Viability upon GlucoseStarvation. The functional…
A: The text that is presented seems to be a figure legend from a cell biology research paper. It…
Q: Who would you expect to be most at risk for developing the bone disease rickets? A) Children born to…
A: The objective of the question is to identify the group of people who are most at risk for developing…
Q: III. Illustrate a cell with a chromosome number of N = 2 in each of the given stage of the cell…
A: The cell cycle may be a series of stages that a cell experiences because it grows and separates. A…
please answer part a
Step by step
Solved in 1 steps
- In vitro experiments are conducted at pH = 7.4 to simulate physiological conditions. A phosphate buffer system is often used. H₂PO → H₂PO¹²¯ +H+ pK₁ = 7.2 a. What must be the ratio of the concentrations of HPO to H₂POд ions? b. What mass of NaH2PO4 must be added to 500.0 mL of 0.10 M Na₂HPO4 (aq) in the preparation of the buffered solution?You have been provided with stock solutions of: stock A: 0.06 M sodium pyrophosphate buffer pH 8.5 stock B: 3 M ethanol stock C: 0.015 M NAD+ stock D: milli Q water Determine the volume you will need of each solution to prepare a buffer of with a final volume of 60 mL containing 10 mM sodium pyrophosphate pH 8.5, 100 mM ethanol, 1 mM NAD+. i.e. volume of stock A = _________mL volume of stock B = _________mL volume of stock C = _________mL volume of stock D = _________mL Show your calculations to arrive at your answers.1. Calculate the pH of the following solutions: A. [H+] = 1.36 x 10-9 M В. [ОН] —D 3.86 x 10-8 М 2. Calculate the pOH of the following solutions: A. [OH-] = 8.6 x 10-8 M В. рH %3D 3.2 3. What is the pH of a buffer prepared by mixing 100 ml 0.050 mM NAH2PO4 and 25 ml 0.075 mM Na2HPO4? (рКa1%32.2; рКо23 7.21; pКаз312.7)
- Phosphate buffered saline (PBS) is a physiological buffer often used in biology experiments. Because the concentrations are very low and small amounts are difficult to weigh out, it is often prepared as a 10X stock solution meaning that it is prepared at 10 times the working concentration which is 1X. 1X PBS is made up of Na2HPO4 10 mM (MW 141.9 g.mol-1); KH2PO4 8 mM (MW 136.08 g.mol-1), NaCl 137 mM (MW 58.44 g.mol-1) and KCl 74.5 mM (MW 74.5 g.mol-1). You decide to prepare a 1 L 10X solution of PBS. What is the Molar (M) concentration of each of the components in you 10X stock. Write your answers in the table below. How much of each of the components should you weigh out to prepare 1L of the 10X stock solutions. Write your answers in the table below.7. · In the space provided, sketch a titration curve (pH vs H+ ions dissociated) of a phosphate buffer shown below. The pKa of H2PO4 is 7.0. H,PO, НРО, + 9. 8. 7 pH 3 1.0 0.5 H+ dissociated --> b. What is the effective buffering range of this acid? At what pH will you have 25% of the buffer in the form of H2PO4? с.Acetazolamide is a drug which inhibits carbonic anhydrase. Carbonic anhydrase participates in regulation of the pH and bicarbonate content of a number of body fluids. Figure 2 shows the experimental curve of initial reaction velocity (as percentage of Vma) versus [S] (concentration) for the carbonic anhydrase reaction. The graph also shows the curve in the presence of acetazolamide. 100 No inhibitor 50 Acetazolamide 0.2 0.4 0.6 0.8 [S] (mM) Figure 2 (i) Compare the maximal velocities and Michaelis Menten constants of the enzyme in the absence and the presence of the inhibitor acetazolamide. Determine the nature of inhibition by acetazolamide. Explain your answer. (ii) Name TWO (2) other types of inhibitions besides the inhibition shown by acetazolamide. Sketch a graph of V versus [S] showing curves in the absence of an inhibitor and in the presence of the types of inhibitors not shown by acetazolamide. ("AJO %) A
- 1. What volumes of 50 mM CH3COOH and 30 mM NaCH3CO0 solutions are needed to prepare 2L of 20 mM acetate buffer pH 3.6? (pka for acetic acid is 4.74)Acetazolamide is a drug which inhibits carbonic anhydrase. Carbonic anhydrase participates in regulation of the pH and bicarbonate content of a number of body fluids. Figure 2 shows the experimental curve of initial reaction velocity (as percentage of Vmax) versus [S] (concentration) for the carbonic anhydrase reaction. The graph also shows the curve in the presence of acetazolamide. 100 No inhibitor 50 Acetazolamide 0.2 0.4 0.6 0.8 (S] (mM) Figure 2 (i) Compare the maximal velocities and Michaelis Menten constants of the enzyme in the absence and the presence of the inhibitor acetazolamide. Determine the nature of inhibition by acetazolamide. Explain your answer. (*"A JO %) A1. What is the molality of the following solutions? a. 171.9 g of Sr(NO3)2 is dissolved in 1.44 kg of water. b. 0.883 g of K3PO4 is dissolved in 40.0 g of water. 0.250M=0.250mcl kF IL scl i80.anilio (6250 mcl 0.500M=0.500md wO IL Som
- 3. Show that the inverse of equation 29-78 in the textbook gives the Lineweaver-Burk Equation. The hydration of CO2 is catalyzed by the enzyme carbonic anhydrase. For a total enzyme concentration of 2.32 x 10-⁹M, the following data were obtained. [CO2]o (M) v (M/s) 0.00125 2.78 x 10-5 0.00250 5.00 x 10-5 0.00500 8.33 x 10-5 0.02000 1.66 x 10-4 Plot these according to the Burke-Lineweaver Equation and determine the values of Km, the Michaelis constant, and k2, the rate constant for product formation from the enzyme-substrate complex from the slope and intercept of the plotted data.3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your answers using two decimal places. Follow this format in typing your answers: answerabbreviated unit (e.g. 3.00 g, 0.75 ml, 10.25 mg): Components Amount per liter Polypeptone 3.0 g N22HPO4 5.64 g (Available as NazHPO4 · 7H2O*) Monopotassium phosphate 0.225 g Sodium chloride 0.5% KCN 0.075 g (Available as 10,000 ppm solution) *MW (g/mol): Na-23; P-31; H-1; 0-16 3.3. Monopotassium phosphate /rRp Dextrose hydrous 50.0 g Sodium Chloride 9.0 g Calcium Chloride 0.3 g WFI (Water for injection) qs… 1 L Calcium Chloride MW: 111; Sodium Chloride MW: 58.5; Dextrose MW: 198 a. Please calculate how many mOsmol/L is the above LVP solution? b. How many mOsm/L Ca++ and Na+ contain the above solution? c. What is the above LVP solution tonicity?