1,3-Cyclopentadiene has to be used quickly after it is made, or stored cold. Which reaction below is the reason it has to be used so quickly? 10.1-0 A B C + H₂O HO D + H2O S OH O O C O D A B
Q: Draw a triacylglycerol (triglyceride) made from glycerol, myristic acid [CH3(CH2) 12COOH], palmitic…
A: Step 1: Step 2:
Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…
A: Le Chatelier's principle states that if a dynamic equilibrium is disturbed by changing the…
Q: None
A: Here te aldehyde group is more electrophilic compared to the anhydride carbonyl. So the alkyl anion…
Q: Be sure to answer all parts. Enter your answer in scientific notation. Calculate Ke for the…
A: Step 1:-Given the equilibrium equation: 2SO₂(g) + O₂(g) ⇌ 2SO₃(g)We have Kp = 2.5 × 1010 at T = 4.5…
Q: Answer the questions in the table below about this molecule:
A: Step 1:
Q: A 3.0-kg cast iron pan absorbs 1.08 × 105 J of energy as its temperature rises from 20°C to 100°C.…
A: Let's answer each question one by one:Specific Heat Capacity of Cast Iron:We can use the formula…
Q: 17. What can you say about the reaction below? 1. OsO4 2. NaHSO3 ? A. This reaction will generate…
A: Step 1: Step 2: Step 3: Step 4:
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: Step 1: Aldol Condensation :Two molecules of an aldehyde or a ketone, containing at least one…
Q: When two molecules collide, which requirements are necessary for a new product to be formed? Select…
A: Step 1: Conditions of collision theory are given below - (i) Molecules must collide with a…
Q: Draw the structures of the major organic product(s) or condition(s) denoted by A to E in the…
A: Step 1:• Mechanism: • In the first reaction, hydroboration oxidation reaction occurs in which…
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: 15. What is the pKb of CN-, the conjugate base of HCN? 228 a. 10.40 b. 4.60 по ai.VI noitesu ni ODH…
A: CN- is the conjugate base of HCN because HCN can donate a proton (H+) to become CN-.pKb is the…
Q: What would be the major product(s) of the following reaction? །། Brtw HO 20°C (CH3)2CHCH20 I…
A: Tertiary alkyl halide in the presence of alcohol will either undergo SN1 (nucleophilic substitution…
Q: CH3 CH₂CCHCH2CH2CH3 CH, C1 CH3 CH3CCHCH2CH2CH3 CH3 Cl H₂O frío Mecanismo: H₂O calor
A: Step 1:Reaction 1: The first reaction occurs at a lower temperature (frio), where simple SN1 type…
Q: The type your answer... type your answer... of a solution is a measure of the concentration of ions…
A: Ionic Strength (I):Reflects the total concentration of dissolved ions in a solution.Accounts for the…
Q: HO 义 H2SO4 E + F major minor G Identify and label the nucleophile and electrophile
A: Approach to solving the question:Detailed explanation:Examples: Key references:
Q: how to synthesize this?
A: 1. First, we need to halogenate the alpha carbon (the carbon, adjacent to the carbonyl carbon)We…
Q: Predict the major organic product(s) of the reaction shown below. OH A only B only C only H₂O - ? OH…
A: The major product will be A because addition of -OH takes place according to Markonikov's…
Q: (a) Compute the voltage at 25°C of an electrochemical cell consisting of pure cadmium immersed in a…
A:
Q: Zinc oxide can be used for treating certain skin conditions. Determine the molar mass of ZnO.
A: The molar mass of zinc oxide, ZnO, is the sum of the molar masses of zinc and oxygen. With zinc…
Q: Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…
A: Step 1: Step 2: Step 3: Step 4:
Q: :$;$;););):$::$:&&:$$;$;;$
A: Step 1: Information: As their are different types of reaction performed with alkyne gives diffrent…
Q: Please answer 22
A:
Q: Step by step full solution
A: Step 1: The electrophilic carbon atom (the carbon atom that has a chlorine connection to it) is…
Q: Name this with the IUPAC
A: In case of any doubt please feel free to ask.
Q: Complete this acid-base reaction, and label the acid, base, conjugate base, and conjugate acid.…
A: Step 1:Step 2:
Q: Question 2. A homeowner uses 4.00 x 103 m3 of natural gas in a year to heat ahome. Assume that…
A:
Q: Listen For the equilibrium system represented by 2C(g)+D(g) Elg), the equilibrium constant (Kc) is…
A: To calculate the final (equilibrium) concentrations of C and D, use ICE table to relate quantities…
Q: None
A: Approach to solving the question: Detailed explanation: Examples: Ke
Q: 17.43 Draw the products of each reduction reaction. NaBH4 CH3OH OH [1]LIAIH [2] H₂O [1]LIAIH4 OH d.…
A: (a)(b)(c)(d)
Q: What is the major product? он HOT OH LOH OH LOH он HOT NHz OH Он NV
A: Step 1: Step 2: Step 3: Step 4:
Q: 5.30 The average enthalpy change of vaporization of benzene between room temperature and the normal…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Answer the questions in the table below about this molecule:
A: Detailed explanation:Identification of the Molecular Structure: The molecule presented,…
Q: Please draw out neatly ;&;&;$;$;$$;!!;!;!
A:
Q: 1, Solve the Schrodinger Equation (SE) of particle in a well (PIW) using complex exponential…
A: The image you sent depicts a step to solve the Schrodinger Equation (SE) for a particle in a well…
Q: Show work, thank you!
A:
Q: 2. When 4.21 grams of potassium hydroxide are added to 250. mL of water in a coffee cup calorimeter,…
A: Please see the attached image for the solution. If there are queries, please do not hesitate to…
Q: balance this equation : HF(aq) + LiOH (aq)
A:
Q: :&;$;$:$$:$$;$;
A: It seems like you're describing a series of reactions involving bromine (Br2) under various…
Q: below. Draw the structure of each intermediate for each reaction. You can use anything with a…
A: Step 1:Step 2:Step 3: Step 4:
Q: None
A: The reaction is to be balanced in the basic medium, so we will use the charge balance method:First…
Q: Sagar
A: Step 1:Entropy is the measurement of disorderness or randomness. Gaseous particles have more…
Q: egg : 4) Provide a detailed mechanism for the dehydration of 3-methyl-2-butanol with aqueous…
A: Step 1: Step 2: Step 3: Step 4:
Q: The reaction rate can also be described by the rate lawRate = k [S 2 O 82- ] x [I - ] yThe exponents…
A:
Q: An arctic weather balloon is filled with 40.3 L of helium gas inside a prep shed. The temperature…
A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…
Q: 121 (OL) Lab 3 Den... V Layout Search References Mailings Review View Help 1 2 3 5 6 I i Lynette…
A: Given data :Density of aluminium is 2.6989 g/mL.We can convert it to g/cm³, we know 1 cm3 = 1 mL…
Q: None
A: a)Step 1 adds nitro group to para position (methyl is an ortho, para director).Step 2 reduces nitro…
Q: :$;$::):;));:$::$;
A:
Q: Please don't provide handwritten solution.
A: Detailed explanation:Understanding the Relationship Between Isomeric Structures in Organic…
Q: Calculate the solubility of Zn(OH), in water at 25 °C. You'll find Ks sp Round your answer to 2…
A: For No. 1: Zn(OH)2 will dissolve and dissociate based on the following reaction Zn(OH)2⇌Zn2++2OH−…
Step by step
Solved in 2 steps
- Questão 10A certain hydrocarbon had the molecular formula C16H26 and contained two triple bonds. Ozonolysis resulted in CH3(CH2)4CO2H and HO2CCH2CH2CO2H as the only products. What is the reasonable structure for this hydrocarbon? Hexadec-6,10-dino undec-1,5-dino Hept-1,5-dino hex-1,5-dino nahReactions: Draw the Structure(s) of the Product(s) + Br2 + HBr он KMNO4 lots of + HBr H2SO4 OH 180 °CWhat are the reagents A and B in the scheme below? Br CH3 в CH,CH,CH,C-CH, A HgC CHy H;C CH
- Elimination reactions of cis- and trans-1-bromo-2-methylcyclohexanes with Eto in ETOH could potentially give the two products, 1-methylcyclohexene (1) or 3-methylcyclohexene (2). Which answer (a-d) indicates the major products for each reaction? Br „Br EtO Eto "CH3 ELOH `CH3 *CH ELOH "CH3 cis trans Select one: a. 2 from the cis and 1 from the trans substrate b. 2 both from the cis and trans substrates c. 1 both from the cis and trans substrates d. 1 from the cis and 2 from the trans substrate7-55 trans-1-Bromo-2-methylcyclohexane yields the non-Zaitsev elimination product 3-methylcyclohexene on treatment with KOH. What does this result tell you about the stereochemistry of E2 reactions? CH3 .CH3 кон Br H trans-1-Bromo-2-methylcyclohexane 3-MethylcyclohexeneIdentify the reagents needed for the given reaction. -c-CH3 || Ĉ-CH3 || ċ-CH2B1 Select one: HBr О НBr O Br2, H20 O Br2, hv O Br2, OH
- Which of the following reagents would you use to prepare Chlorocyclopentane from cyclopentene? OC2 / H20 NBS / H20, DMSO OCh/ CH,Cl2 HCIThe correct sequence of reagents for the following conversion is: Br N T OH Br OH BrDichlorocarbene can be generated by heating sodium trichloroacetate. Propose a mechanism for the reaction, and use curved arrows to indicate the movement of electrons in each step. What relationship does your mechanism bear to the base-induced elimination of HC1 from chloroform?
- Provide the mechanism and products for the acid-catalyzed epoxide opening reactions below, including appropriate stereochemistry.tert-Butyl esters [RC02C(CH3)3] are converted into carboxylic acids (RCO2H) by reaction with trifluoroacetic acid, a reaction useful in protein synthesis (Section 26-7). Assign E,Z designation to the double bonds of both reactant and product in the following scheme, and explain why there is an apparent change in double-bond stereochemistry:9:33 AM Tue 25 Jan * 99% Assignment 5 What products would you expect from the following reactions? (a) CH3CH2CH2C=CH + 1 equiv Cl2 → ? (b) CH3CH2CH2C=CCH2CH3 1 equiv HBr (c) CH3 CH;CHCH,C=cCH,CH3 Lindlar + H2 ? catalyst