1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.
Q: C. Mucic Acid Test for Galactose and Lactose describe the appearance of a few typical crystals…
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Please answer both of the following 1) The Haworth projection of D-altrose is shown What type of…
A: The cyclic structure of Glucose : The cyclic structure of furanose : The cyclic structure of…
Q: I. Enzyme activity can be regulated by allosteric enzymes, feedback control, and covalent…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: If the following monosaccharide underwent cyclization to form a furanose, which of the following is…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Which of the following results are most likely to be observed in liver enzymes following initiation…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: What elements do lipids contain?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: A dipeptide is a two amino acid linked via a peptide bond. The peptide bond is formed between the…
Q: There is also another follow up question can you help me with this too please In the second cross, a…
A: A rabbit's coat colour is determined by four alleles: agouti (C), chinchilla (Cch), Himalayan (ch),…
Q: Draw the structure of alanylserine, a dipeptide made from alanine and serine, as it would appear at…
A: A dipeptide has two amino acid residues. Amino acid sequences are written with N-terminal amino…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which of the following molecular formulas would be for an aldopentose? C4H8O4 C₂H₁408 C6H12O6…
A:
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: You want to study a biomolecule in the laboratory. You have ordered the synthetic gene from a…
A: The process by which a specific gene sequence of interest is ligated and then the newly synthesized…
Q: 7. Specificity of membrane transporters. A protein that transports amino acids across the cell…
A: In competitive inhibition, the inhibitor competes with the substrate for binding at the active site…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 9. PFS in erythrocytes, its biological significance, manifestations and consequences of…
A: PFA or progression-free survival is "the amount of time a patient experiences the diseases but does…
Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: If a slight deficiency in the Vitamin B1 derivative Thiamine Pyrophosphate (TPP) leads to an…
A: TPP is a cofactor used by many enzymes. TPP helps to cleave bonds near to a carbonyl carbon.
Q: b-oxidation occurs ONLY under aerobic conditions. Why? Glycolysis occurs under anaerobic conditions,…
A: Beta-oxidation of fatty acids is the process by which long chain fatty acid molecules are broken…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…
A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…
Q: Add curved arrows to show the mechanism of nucleophilic attack. Select Draw ||||||||||COH P : 0: | :…
A: A nucleophile is a chemical species that is negatively charged or has a high electron density or a…
Q: What else? What are cofactors? Carboxypeptidase requires a Zn²+ cofactor for the hydrolysis of the…
A: Since in the question it is mentioned to answer any three questions, question 2, 5 & 6 will be…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Pyruvate is the end product of glycolysis. In the presence of oxygen, it enters aerobic respiration,…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: FLUORESCENCE BINDING a) In the DAPI DNA lab, concentration of DAPI and DNA was determined to carry…
A: Dapi is a fluorescent dye. It binds to the AT regions of double-stranded DNA and emits fluorescence.…
Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…
A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are bio molecules that are made up of fatty acids and glycerol. They are insoluble in water…
Q: Draw the structure of the following: (in the image provided) Use the amino acids below. F -…
A: Recall that: Amino acids have an amino group, a carboxyl group and a side linked to the same carbon…
Q: 21. _____________________________________ adds acyl groups to two carbons of the backbone of…
A: Triacylglycerol (TAG) are compounds which has 3 acyl groups attached to a glycerol molecule. Fatty…
Q: Do carbohydrates and sugars cause weight gain? Explain your answer.
A: Your body receives 4 calories from every gram of carbohydrates. You will gain weight if you consume…
Q: When tissue of the body are unloading CO2 into the blood, what best describes what happens to most…
A: Hemoglobin is a protein found in RBC. In addition to carrying oxygen from the lungs to the tissues,…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…
A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: What is the function of CTAB being added to the cell culture before performing the enzyme induction…
A: Cell culture is the propagation of cells by providing a controlled physiological and physicochemical…
Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: The structure given below represents what molecule? CHO I H-C-OH I CH₂OH dihydroxyacetone phosphate…
A: The molecular weight of glyceraldehyde, a pleasant, white, crystalline solid, is 90.08 g mol 1. 29…
Q: Show a calculation of change in standard reduction potential that explains why succinate is not…
A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: ОН ОН ОН tautomerization
A: Tautomerization is the process by which structural isomers interconvert between each other. The…
Q: CH3C(double bond with O)COO- (aq) + H2O(l)⇌ Pyruvate, a product of glucose metabolism Express your…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: Which enzyme activity would be inhibited if fluorodeoxyuridine-5 monophosphate is present?…
A: The compound fluorodeoxyuridine 5’-monophosphate (FdUMP) is a compound that has similar structure to…
Q: A technician checks the column bed volume on a column that is supposed to be 2ml. If the bed volume…
A: Column chromatography is a separation and purification technique. Column chromatography requires a…
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Choose the best answers for each missing word from the list below. ____ regulated by ATP, Aspartate…
A: Enzymes are proteins found in the cell, these are bio catalysts that speed up the reaction without…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 3) 6. What is the main reason for there being both a leading and a lagging strand during DNA replication? To answer the question please: traw a scheme of DNA replication and mark the direction of replication fork movement; 2) name the proteins that are required for DNA replication. monar initiate7. What enzyme synthesizes small primers for DNA polymerase to bind to so it can initiate DNA replication. What are these primers made of? To answer the question please: I) name the proteins that are required for DNA replication; 2) draw a scheme of DNA replication; 3) design a primer for this DNA fragment: 5'-AATTGGCA-3,I. Compare how Bacteria, Archaea, and Eukaryotes differ on each of the following aspects of DNA replication: 1. How do the number and types of DNA polymerase differ between these three groups? 2. How does the physical location in the cell of DNA replication differ between these three groups? 3. Are there differences between these three groups in the timing of when DNA replication occurs in cells? 4. How does origin of replication differ in terms of number and location between these three groups?
- 1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.Define DNA replication/synthesis and semiconservative replication. In addition, describe and/or define the role(s) of each of the following in the process of DNA replication/synthesis: DNA template strand, 5’ and 3’ ends, DNA helicase, DNA polymerase, single-strand binding proteins, topoisomerase, primase, Okazaki fragments, leading strand and lagging strand.
- 1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand
- 4. During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked. Why does this occur? Option 1a) replication starts at many points on the chromosomeOption 2b) replication can only start at one place on each strand of DNAOption 3c) RNA primers only anneal to one of the parental strands of DNAOption 4d) DNA polymerase III only synthesizes DNA in the 3' - 5' directionOption 5e) DNA polymerase III only synthesizes DNA in the 5' - 3' direction A piece of double-stranded DNA consists of 18 nucleotides. How many codons would the first-formed mRNA transcript have? Option 1a) 18 CodonsOption 2b) 9 CodonsOption 3c) 6 CodonsOption 4d) 3 Codonsa) Explain semi-conservative modelmof DNA replication b) discuss initiation in DNA replication and explain why it is a tightly controlled process.Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid celldivision, replication could start from the origin before thepreceding replication cycle is complete. How many replication forks would be present under these conditions?